Description :
From Genome Similarity Track
Location :
Scaffold_8:276255- 278637
Sequence
2382 bases(100 bases per row)
CGTATGAAGACAAACAATAATCCGCAATGCCGCAATATTCAGTGTATTTTTGCGAACAAGAGCTATCACGGCACTTGCGTCGACGCGTTCCAGAGATCTC
GGTTAGCTTTAAGAAACATCAATCTCTCGAAGTTAGCTGAGCGCATGGAGGCACGGTGCGGCTCAAGCACCTACTTACACTCCGAGAAGAGCCGCTCACA
CCGGTTCCTCGTTGGTGGGATGACACTGAGAAGTGGAATGTAGTCGACAGCACGCCTCGGGGAGTAACGTGGCTTCTTGGCACGGCGCAGAATCTCACTC
GCAAAGTCAGCGGCTGGTTCATCTTCACTCTGGCCAGGTCTTTCTGGGCGCCGAAACGCCTCGATCGCCTTGGCTTCTGCACTGAATACAGGAAGAGCAC
TCGTGACCTTGATGACCGCTGCTTCAAAGACCGGTGAATGAACAATCTCGGCTGTAGGCTTCAGATACTCTTCCATGACAGGGTACTTTGCCATGCAAGC
GTCAAAAAGAGCACGGACCTCACCAAGCGTTCCGCTGTGATGCTGCAGCTTCTCGCTGACGCTCTGGAGCTCCTTCAGCTTGTCGTGCAGCACTCGAATC
CGGCGATGCTCACTCAGACGGGGGAGCAGCTCTTCGACCTCGGCAACGTGCTTCGCAGCGTCGCGAAAGCACACATACTTGTGTACCATTTTCCACACCG
ATGACCAGCGAGTCGCATTTGCTTTCTTAGGCAGTAGCGCTGTGTGAAGTGCTAACTGAGGGCTCTGTTTGGGGCCACCCTAATTATCGTATCGGAACAT
TCCATTTTAACGTATTATTAATAATCACTTGATAGCACGGTATCAGTTTAGTGCACTTGGTAAAGATCCGTCCAATCAGTGCAAATTATTAATGATATTC
ATCATATTAGTGGTTAAAATAAGCTAAATTAGTTTAGTTCGTGCCAAAATATCACATTTGACCCTAAATAATCAGCTTCTACAGGAATACGATTTTGATG
GCACCCAGAGCTTAGCGCTGGCGATGCGGGTTTTTCGTAGTCTTGGCACTCCTGTGGCCAAGTCGTGAGCATGGCGGTGCGCTGCGTGAGCTACAAGAAG
GAAGACCCCGAAGAGGCGCTGGACAGAGCGTACGAGGTAAGACTACGAGCAAAATAGATTATTGGTGCAGCAATATAGGCACACAGTGAGGGCACAAGTA
CTAAAGAAGGTATGGCTGATTGAACACTGCCCAATAGATTATTGGTGCGCGAAAATAAATAATTGGTTTATCTCTCTAATAAATTATTGGTGATATATTA
TTGCAATAAATGTGACGCCAATTTGATTTTTCGGCATCCCTGAGTGTGCCTTCTTTAGATTACTATTCTGAGAAAGCGTATATAAGCAGAGATAATACGT
ATTATGAATGGTCGCGTTCGCTCCGCATAATTCGTATTATGGGCAAGATAATACGTATTATGTGCTCAACAAACACGGCCTAAGTCTTATTCTGGAATCT
ACAGCTCCTCGTTTCAATAAATTACTTGCTTGGTCTGCATAGTTTGCTTGTCAGGAGCGTATTTAAAATACTGCACTCAAGGGATTATTTACGCTAGCCA
ATAAAAATTGAGTAGATGCATTTTCCACAAATTCCACAAAGCGAAGCTCCTTATAGTTATTATATCAACATTCGTGCAACAGCCCATACTAAAGTCCATC
AAATAGGGATACCTTGAGTTTTGCACATCGCGATTATTGCTAGCACTAATTGGCTGTAAACAGCTCAGTTAAGCGCCAACCAAACCAGAAATTACCGTAT
CCGCTCCAAACGAAGAAGAAATTACTTTAGGAGCTACCATATGTATCTAAATGTCGATATAGGTTTTAGAACAGCAAAACACCTTAATTATAGCGCAAAG
TCCGTCCGAGGTTTGGTGGCCATAAATGTGCCAATTCGCTGGGGCACCTTCACCCACTGTACACTTAGATACTACGTAGTAGGAATTTAATTCTGGTTTC
CGGCGCTATGACTTCGGAGGGTTTTATTTTAATAATAGTCCTGGATTTTAATAAGGGTAGCGCCTGTGTTTGAACACCACACGATCCCATTTTCAATCCT
CCTGCGTGCAGCGTTGTGGAGTCCACAATGTGGTCACGACTTCACAGCTTTGTAACCTGACTCAGAAACAACTTGTTGACAGAAGGCGGTGCTCATCTTT
GCTAAGTTTAACGGGATTCATATAATAGTTCTGTACGTCGAATCGACGATATTTGATACGTAATATGTATTAATACATGAGCACCGCCTTCTGTCAACAA
GTTGTTTCTGGGTCGACGGGGTGGCCGTATAATTGGGTCCAGGAGTGTATTACTATTGTAATTCTTGATACCAAAAAAGAGC