Description :
From Genome Similarity Track
Location :
Scaffold_2:27625- 28956
Sequence
1331 bases(100 bases per row)
TGGGCCTTGAGACCTATCTCCACCACTACTCGAAGAGCTTCGCTGCGACGGTTCGCCCATTGTCGCAGCTCCTTAAGCTGATGTCACGTGGTTGTGGCGT
CCCGAACACCAGGCTGCGATTGACTCGGCGAAACAGAGCTTATCCACCGCACCCGTCCTCATACTTCCTGATCACTCATTCCACGTTGTCTGCAACGCAA
GCGACTTTGCGATCGGCTGCGCCCTGGTGCAATTAGACGACGAAGGCCACGAGCGGGTCGTGAGCAACCATTCGCGCCAGCTGAAGCCGGCGGGACGCAG
CTATACAGTTCACGACAGGGAACTACTGGCCATGCGCTACGTATTGATCAAGTTCCGCGTCAATCTCCTTGGAGAGTAGATCTTTGCAATCTACACGGAT
GACGCGTCGCTACGGACAGCGACGAAGAGCCCTCATCTGCCCCAGTGCATGGCGCGCTGGCTCTCGCTGTTCTCCGAGTACAACTTTGTTGTTCACTACA
AGCCTGGTAAACCAACATCCTCGCCTGCGCGACAGCGCGTCGGCCAGGCTACGTGCAGTCGGGTCGCCACGCTGTTCGCGACGAGGATGAAAACGGTTGT
GCAGTGTGCAGTGTGCACAACTGAAGAGCAGACAGCAGTCGCAGTTACTGCTAACAGTCCTCTCCGTGACTTGATCGCGTCCGCGTATGAGTCGAACGCT
GTGTGCATAGAAATTATCAAGTACTTGACGGATCCATCCACCGCGGCGCGGCGTCAATTATCCCCACGCGGTCGCGCCCGTATTGACCGCTACGCGCTCG
ACAGGAACCTGCTAACATTTTGCATCGACCGCTCGGACCCTCCACGCGTCGTCGTCTCGCTAGACGATGGCCTACCCGCTCGCCTGATTCACGAGTTCCA
TGATACTCCCAGTGGCGGTCACTTCGGTCGCGAGAAGACGTTTGCGTCGTTGTCTCGCGACTACTACTGGCCGCACATGTACAAATGGGTGCGGAAGTGG
GTCCGCTCCTGTGAGGCGTGCCAAAGGGTGAAGCCTTCAGCGGCGAAGCAGGCGCCGCTTCATCCTCTTCCGGTTGCAGATGCACCGTGGTCCTCCGTGG
GCATGGACTTTTTCTTTGGATTGCCTCGGGATGGCCAAGGCCACACTGGTATCCTCGTCTTTGCTGATCGGTTTAGCAAGATGGTTCATCTTGCTCCTGT
GGCTGCTTCCATCACCGCTCAACGATCTGCGGCGATCTTCGTCGATACTGTCTATCGACACCACGGCCTTCCAATCTCGATCGTATTTGATCGAGATCCT
CGCTTCACTGCCACTTTCTGGAGAGAACTGT