Description :
From Genome Similarity Track
Location :
contig_50:276225- 282971
Transcript NameFunction/comments
g10386.t1XP_008911108.1 hypothetical protein PPTG_15600 [Phytophthora parasitica INRA-310

Sequence
6746 bases(100 bases per row)
GCAGGGATGGCCATGACGCCCGGTGGCAAGATGGACCGCCGCCGCGCCGGCTCCAACTACTTCCAGCTCGACGCGGACCGCAAGCGCAACACGTCGGCCA
ACCGGTCGCACCTGAACGGGGACGGGCGCGGCACGTTCGGCGACCGGCTCAGCATGATGGACGTGCTGCCGCCCACGACGCACGGGGGCAACCAGCTGCG
CGGCGGCGGCCTCGAGGGCGACTTCGCGGACGAAGTGTCGGTGGACTTCTGCTGCGAGGTGCTGTACAACAAGTTCGGCTTCCAGTCGGGCTCGGTAGAC
AACCAGCGCGAGCACGTGCTGCTGCTACTGGCCAACGCCAAGGCGCGCTCCAAGCCGCAGGACCCGCCGGGCCACCACGTCGTGACGCTGCACAAGAAGC
TCATGAGCAACTACACCGAGTGGTGCCAGTTCATCGGCGCGGGGAGCGTCACGTACACGGGACAGGCCCAAGGAGACCTCAAGAACCCGCTGCATATGGA
CATTATGCTCTTCCTTCTGCTATGGGGGGAGGCTGCCAATCTGCGGCACATGCCCGAGTCTCTCTGCTACCTGTACCACCAGGCGGTCAATATGCTCAAC
CAGGACTTCCTCGGACAGCAAAAAGTACCCGAAGGATGGTACCTCAGACAGGTGGTGCGTCCTATTTGGAAGGAGGCCAGCAACATGCAGCGGAAGAACA
GCTTGGGCAAGAACTTGGAGCATACGCAGGTGCGCAACTACGACGACATCAACGAGTACTTTTGGAAAAAGTACTGTTTGAATGTGGATATCACCCACAT
TGGCGAGGAACTGACCAAGAAGCACACCAAGACGTACTACGAGCACCGTAGTATTTTCACGCTCGTGCTCAACTACTACCGCATTTTCCAGTTCAACATG
ATGTTCATGATGGTGCTCATGGCTATTGGCTTCATCTCGGCCATCTCGCCCAGTGGCGGCCAGCAGTGGTTTGCCCAGTTTGGCTCCATGGGCGAGGTGG
TGGAGCCCTACCAGCAGCAGGACGTCAAGCTCACGTACGTGGGGATTGTGTGCGCGCTCTCCACCATGGGGTTCTGCAAGACCGTCTTAGAGGCGTGTCA
CGGATGGCATTTGCTCACAGCCAGCGAGGCTTCCGCTACGTCGTCACGGTCGTTCAACTACGGAAGTGCACTGGTTGTTCGTATGCTCTGGAACGGAGCG
TTCGCTGGCATCTTCGGGTTGATGATTTACACTCCACTCATCACGAGCAAGAACACTGAGCTGTTGGACAAGGCTGCTCCAGCGTCAATTGCCTACATTA
TGCCTGGCGCCTTGATCATGACTGTCCAGGCTTTTGCCCCGTCGATGGTCACCAAGACGTTCGCGGCCAAGTTCATCCGTGAAGGTGAGTCGTGCTTCGT
GGGACGCAACATGGCGCCTCCGCTCAGCTACCAGATCAAGTATATCACGTTCTGGGTGATTCTGTGGGCGCTCAAGGCGTTCGTCTCGTACTTCATCCTG
GTGCGTCCGCTGGTCTTGCCGTCGCTTGCCATCTACGAGATGGATCTCGAGTACGGTAGCAACGTTGTGTCGTTCCACAACTTCGGCGTGATCCTGGCGC
TGTGGATGCCGGTGGTGTTCATCTTCAACTACGATACCCAGATCTACTTCACGATCTTCCAGGCTACTCTCGGTGGTATCCAGGGCCTTATCATGAAGAC
AGGTGAAATTCACGGCATCAAGGAGATCACGAAGGCCTTCCGCGTCGCGCCTCAGCTTTTCGACCAGAAGGTGGTGACCAACCTCGCTCGCTCGAACGAT
GCTGCCGCCGATGGCTCTGCTGCCGCGTACCAGTCGCAGATGATGCTGCGCTTCGTGGTCGTGTGGAACGAGATCGTGAACTCGTTCCGCGAGGGAGACC
TGGTGGACGATAAGGAAGCTGCCATCCTGCAGTACGACATTCAGAGCTCCGGCGATGTGTTCGAGCCTGTATTCCTGTCTGCTGGAAAACTGGTGGAGGC
CCTCGACTACACAGTCAAGTTGGCTAAGGAGGGCAAGGGTGACTCGCAGCTTCAGGTGTACATGGTGCAGAAGGATTGCCTGTCTGCGGTGCGCAGCTTC
TTCACGGCCAGCATGTACGTGATGGAGGCTTGCTCGGCAGCGACGATGCGGACATCCTCGACGCGCTTCGCCAAATGGAGGCGATTGCTGCCAACGGTAG
CTTCATGAGCACGTTCGATGCCAAGAGCCTTGTGCAACTGCGCACTGTGTCCATGGAGTTCTTGGAGGCCGTGATGGATCTGCCTGACCCGGATGCTCAG
TCCTCGCACTTGACGACATCCAGGGTGCACACATGGGTGTCGTGCGTAACTTCGTGACGAAGATGGAGAACTTGCTCAACGCCATCCGCATTCTAGCCAA
CCGCCCTGAACTTGCTGCCAAGTTCAGCAACTCCAAGTTCTGCTCGAGCGCGAACGGCTACGTGTTTGCTGCCCGTGGTCTGGTGAACCTGTTCCACAAC
GACACGGCCATGGGTGCTGCTACCCGCGCGTACCTGCTGATGTCACTTGAGAAGGCTGATGCGATGCCGCGCGTCCCTGAGGCTCAGCGTCGTCTTGGTT
TCTTCATGAAGTCGCTTCTGATGGACATCCCGCAGCTGACTTCGGTGAAGGAGATGCATTCGTTCTCTGTCGTGACCCCTTACTACAGTGAAAGTGTGCT
GATCTCGCTGTCGGAGCTGAACGATCCGCTAGTGAACCACCCAGTCTTCAAGAAGGTCGAAGAGAAGGGCAAGAACATTACGATTCTCAAGTACCTTATT
ACGATTCACCCGGAGGAGTGGGAGAACTTCTTGGAGCGTATTGATGTGGGCTCGGCTGAAGAAGCGCAGGCAAACTACCCGCTGGAGATTCGTCTCTGGG
CTTCGTACCGTGGTCAGACGCTGGCGCGTACCGTCCAGGGTATGATGCTGTACGAAGATGCCATCAAGATTCTGCACTGGCTGGAGATTGGCTCGAGCCC
CGGCAAGACGGCCGAGCAGAAGCAGGCTCAACTGGAGGACATGGTGCGCCTGAAATTCTCGTACATCTGTGCCTGTCAAGTGTACGGTAAACACCGTGCT
GACAACAAACCTCAGGCCGATGACATTGACTATCTTCTGAAGACGTACCCGAACCTGCGTGTGGCGTACGTCGACACCATTGCGTCTGACGGAGGCAAGC
AGTTCGACAGTGTGTTGATCAAGAGCGAGGGCAACGAAATTGCTGAGGTGTACCGTTACGAGCTGCCCGGCGATCCGATTCTTGGTGAGGGTAAGCCCGA
GAACCAGAACAATGCACTTCCGTTCACACGTGGCGAGTACCTGCAGACAATTGATATGAACCAGCAGCATTACTTTGAGGAGTGTCTGAAGATGCCGCAG
CTTCTGGTGACCGCTGACCTGCACCCTTCGAAGAAAGCCTGTGTCGATTATTGGTATGCGTGAGCACATTTTCACGGGTAACGCTTCGTCGCTGTCGAAT
TCAAGTCGTGGCAGGAGCTGGTGTTCGTGACGCTGTCGCAGCGTGTGCTGGCCGACCCGCTGTACGTCCGTATGCACTACGGTCACCCTGATATTTTCGA
CAAGATTATCGCCATGCCTCGTGGTGGCGTGTCCAAGGCTAGTAAGGGTATCAACTTGTCCGAGGATGTGTTTGCCGGATTCAATGCCACGCTTCGAGGT
GGTGTGGTGACCCACGTGGAGTTCATGCAGTGTGGCAAGGGTCGTGATGTGGCGCTCTCTCAGATTTCGATGTTCGAGGGTAAGCTGGCTAACGGTGCCG
GTGAAACTGCGCTGGCGCGCGAGGCTCACCGTATGGGCCAGTTCATGGATTTCTTCCGTCTGAACTCGATGTACTACTCGCACACGGGTTTCTACTTCGC
AACGTGGATGACGATTGTGACGACCTTCGTGTACATGTACTGCAAGTGTACCTGGCTCTGGCTGGTGTGCAGCAGCAGATTGTATACGACATGAACACAA
CTTCCGTGATTACCGAGAACATTGCCAACAACTTCGACGAACGTGTGTTCACGGACCTGAAGGCTGTGTTGAACACTCAGTTCTACATCCAAGCCGGTAC
CTTCTTGATGCTTCCGCTGATGTGCGTGTACTTCGGTGAAGGTGGTCTGGTCCGTGGTATGACGCGCTTCATCGACATGATATCACGCTCGGCCCTGCGT
TCTTCGTGTTCCAAGTCGGTACGACGATGCACTACTTCGACAACAACATCGTCACGGTGGTGCCAAGTACCAGGCCACGGGTCGTGGTTTCAAGATCTCT
CGTGAAACACTGGTGTTGCTGTACAAGGCGTACGCAAGCTCACATTACCGAAAAGCTTGGGAGCTTATTGGCTTGTGTCTCGTGTACTTGACGTTTGGTA
ACTTCTACATCTGTCAGACGGATGCCTCGGCCAACGACAACACCTTCGCGTCCGACTACTGTGATACTTCCCAGGCTTACGGTGTGCAGACGTTCTCGGT
GTGGTTCATTTCCATTCTGTGGGTTGTCGGTCCTTCCTGTTCAACAGTGATGGTCTTGACTACAGGAAAACGAAGGTGGATATCCAGCAGTGGTGTATGT
GGATGTTCGCTCCCGAAGACTTCCAGGACGACGATCCGGCAAACAAGGGTGGCTGGGTAGGCTGGTGGAAGGGCGACCTGGAGCAGCTGCACGCCTCGAA
CATGATTTCTCGTGTCACCGTCATCCTCCGAGAGTGCCGGCACTTCCTGCTGATGTTCTACGTGGCTACACTCGAGACGTCTGACGTGATGTATGTCGCC
TACTCATTCGGTGCTGCCGTTGCGACTGTCGTTCTGCTGGGTGTTTTCCATGGCATCGGTGTGGGCATGCGCTCCATGAGCCCTGTAACTCGCGCGATGA
TTTACTTAGGTACTATGACCATCTGGGTCACGGCGTACTTCTTGGCCACTAAGATTGTCTTGGACTGGAGCTTCACGTACGCAATTTCGTTGTTCTTCGC
CTACGTGGCTGCCTTGTACGGCATCAACGAGTGCTTCCGCATGTGGAGCTTCCCAGGCTCCTCGATCGCCAGCATCCCGATGTTCCAGCAGCTGCAGTTC
CTGTTCGACTTTATCTTCTGCACGGGTATGATCATCCCGCTGGTGATCTTGTCCTGCATCCCGTTCTTGAACGTTATTCAGACGCGTATGATGTACAACG
AAGGCTTCTCGAAGGTCATGTCGGCATCGTCGCAGTACGCGTTCTCGCTGGCCGCCTTCATGGGCATTCTGGGTGGTATTGGTGTTGGCTGGCTGTTCAA
CCTGCTCTCGACGCTGGAGCAGTCGGCAAGTTTTGCGAGTTATGTGGTGACGTACGACGGCGTGCTCAGTGGCAATGTTGGCGACGGCACGACCACCTTC
ATGCTGTACGGCGCCTGCGTTGTCGGCACGATTATTGCTGGCTTCTTGAACTACTTCCTCGGCCGCCGCTTGTCCATCGTTGCCGGTGGTCTGTTCAGCA
CGCTCGGTATGGTGGCTGTCAGTGCCAACGACGACCTTCGTTCAACTCTGCTCATGCCTGGCATTGGTCTGCTCGGCGCGTCTTGCGGTATCCTGCTGCC
GTCACTGGCCATCTACATCTACGAGATCTCGACCAAGGAGATGCGTGGCAAGGCTATCTTGCTGCTGGGCATCGGCTTCATTGCCGGTAGTCTGCTTGGT
GGCATTTTCGCGACTGTGAACCAGTTGGGATGGATCTGGCAGACGTTCGCTGCCTGCATCGTCATTGCGTTGGTCACTCCGGTGGTGAACGTGTTCCCCG
AGAGTCCGTACTGGGTGCTGGACCGCAAGGGCTGGGACGCGTGCGAGGCCTGCCTGGTCATTCTGCGTCGTAAGCCTGACGTGCACGACGAGCTCAAGAT
CATGCGCGAGGAAGAGACCGCTGACGAAGGTGGCTCGGGGCCGTTCAAGTTCCTGATCGGCCTGTTCCTCATGCTGGTTTCGGCGCTCACGACGGGCTTC
TTGAACGCCTTCATCAGCTACAAGGGTGCCAGCGAGTACACCGACCAGGACCAGTTGTTCGTGAACGGCATGGCGCTGCAGATCTCCGGCGCGGTCATTT
CCTTCTTCTTCATCGACAAGCTGGACCACAAGTCGATCCTGTTCGCAACGCTGATCCCCGTGGCAGGCTGCGCGGGCTTGCTTGGCTTCAACGAGTCGTC
GGATCTCCTCGGCAACCCGGAGGGCTCGGGCCTGTACGTCAGCCTGGTTGTCATGCTCATGTACTTCTTCATGGGTCTGGGTACGAGCTCGCCCCCTTGG
ACGGCGTGCGTCGGCATGTTCACGACGCGAGGTCGCGCCTCGTCGACAACGTTCCTGTTCGCGATGTTCTACTTGCCCAACCTGGGATACGTGTACATGC
ACACGCACGACTCGATGATGGCGAACGAGTACTTGTACCTGTACGCGATCGCCGGTCTCTGCGTCGTTGTACTCGTCCTGCTGCTGGGTGCTGGTACCAA
GAAGAACGGCGTCATCTCGACCAAGGCTGAAGGCGAGCGTGACCGCGAGCGTGCTGCTCGTATGCGGGCCGATCGCGCGACTCGCGCTTCTCGTACGCCA
GGTGCGCGCCAGCGGAACCTCAGCCGCGTGCGGTCCAAATCCAACGCTGGCGGCCAGCGCGGCAACGCGACGCCCGGTGCCGGCTACCAAATGTACGAAA
CACCCGCGCACGCTGCGCCGCCGCTCACGCACGCACGCGCATAAAG