Description :
From Genome Similarity Track
Location :
Scaffold_36:276217- 281377
Sequence
5160 bases(100 bases per row)
GTCGAACAAGCCCAACGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGCCATGGAGGTGCATCTAGAATCAC
CTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTACTCGGTTGCTTCG
TAAGCAGCGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTT
GGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAG
CACCAGGATGCTTTAGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCTGTTTAGCGTCGTCTGCGATGCCT
CGGATTACGCCATCGGGTGTGCATTGCTGCAGGCCGACACGGCTGGACAGGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAA
CTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGAC
CACGCGTCCTTGAGGACGGCGACTAGCTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACA
AGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGAT
ACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGACGTCCGACTGGCTCTCGTCGCGACAGCGC
TAACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAATGACGAGGATCTGA
AGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCA
CATGTACAAGTGGGTCGCCCGGTACATCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTA
CCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGA
GCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAAACCGCAAGGATGTTCGTCGATGGCGTGTTCCGCCATTACGGTCTCCCGGA
GACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCCGCGTTTTGGAAAACGCTGTTCCCTTTATTGGGAACTCGTCTGCAGATGTCCACTGCGGACCAT
CCGCAGACCGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTTGGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTC
CAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGCTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCT
TCGAGAAGACACTGACTCCTCTATCTAAGCGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTAAGACCAGTTTCGCTGCGGAAACAGG
TGGAATCCTTTATGGATATCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGTCAAACAAGG
AAGAGGAAACTTAAGTATCCATGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAGCAAACGG
AAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATG
TCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGATCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGAC
GAGGGCGTCGGAGCAGGCACCCAAGTCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCTCGGCGCCAT
ACGCCGAGTACGCTGAGTACGCCGGGTACGAACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCG
GATCATGCAAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGACGATCCACCCGCAGGTGCAGGCTCGCAACCTCTCGCTCCACCAGGTCCAGGCGACCC
GCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCATGAGGACACGTTGACGGA
GGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCAC
CTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGTAAGCGACAGCTCCTCGTGAAGTG
GAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTAAACGACTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAGCTTCATAAGTAGTCC
GGGGCTTCTTGCCCGAACGGGGTACGGACGATAAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTAGCAG
CATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCATGCTGGTCCAGGATGTGGGACAGTTGCTGATCTTCATGAAGTTCCCATAACTCCGTG
GGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACCG
GATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAA
GTTGTCGACGAACAACTGTTCTTTCTTGAACAAGGGCTCGTTCATAGACGCCCCTCGAAGTGTGGCCGCCCACAAGGCCACGAGGGGCGACGAGGACCTC
TAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGACAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGC
ACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGCCATTCGAGACCTCCCGGAGCTCATCAATAGCACCCTCCTCCTCCTCTTCTTCTTCCT
CCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGAAGTGGAGACTTAGAGGCTGTACGCTTCTT
TGAGGGCTTGGCGCCTTCGGCCTTTGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCT
TTGGGAGCACCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGAGCGACTGCACGCTGTCAT
CTTGGGCTCACTGGGCACTGGGCTGTGCCCTCCTACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGGACTCGGCATCGTCTTCACTGTCCGAGTTGAAC
TCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGATGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGG
ATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCCGCCTT
GGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGATAACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCT
AACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTGGT
CGGTAAACCGAACCTAAGTGGGGGAGATGTAACGGGGTACGTAGCCCTAAGTGTGCCCTGGTTACACGAAGTATGACACGTCATACTTCGGGATATTTGG
TACAAAGTACCAAGGTCGTTCAAAGCCAACCATTGGTTGCATTTCTATAGGTGACTTATAGTTTGTATTAAATTCAAACTTAATCTACGAANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATTAACC
CAAACTTAACCTACCTATAAATATACTACCTTATTTATGTTACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGTCGTTCACTGAGAGTTTATA
TACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAGGTACAG