Description :
From Genome Similarity Track
Location :
Scaffold_41:276208- 277453
Transcript NameFunction/comments
Physo_117362DEAD/DEAH box helicase

Sequence
1245 bases(100 bases per row)
TAACGCACTGGAGGAGTCACGTTGTATCCAGGTTGTTGAAGAAGAGGAAGACGACGAGAATGAAGGCGAGGAGCGTCTTGTGCCGCTGAACCTGGGCATG
ATCGCCGCGTACTACTACATCAAGTACACGACGATCGAGCTGTTCGCATGCAGTTTGAAGGCAGACTCAAAGGTGCGCGCGCTTCTCACGATCCTGTCGT
CTGCTACCGAGTTCAGCGACCTGCCGAGCCGCTACGGTGAGGACAAGAAGCTGGAGGGGCTGGCGAAGCACCTGAAGTTCCCGGTGGCTGCTGGAGGCGA
CTACGGACAGGCACACGTCAAGACGAACGTGCTGCTGCAGGCTCACTTCAGCAAGCAGCACGACCGTCTCAGCCCAGCGCTTCGCCAGGACCTGGACTTC
ATTCTGCGCCACGCCGTGCGACTTCTCCACGCTATGGTGGACGTGATCAGTTCCAACGGATGGCTCAAGCCCGCTCTGGCGGCCATGGACCTCGCGCAGA
TGGTTGTGCAGGCTCAGTGGAGCAGCGACTCACCGCTGCTGCAGATCCCGTTCTTCACTCGGGATATGCTCAAGAAGTTAGGCGAGATGGAGTTGGAAGA
GGAGGTGGAGACACCGGTGGATATCCTGAGTATGGAGGACGACGCCCGTGGCAAGCTGCTGCCTCTGGACACGCAGAAGATGTCGGCCGTGGCCAAGTTC
TGTAACGCGTACCCGGATGTGACAGTGCAGACGAAGGTGCAGCAAGATGGCAAGAACCTCCCGCAGGGCTCGGCTGTGAGCGTCAAGGTGCAGCTCGAGC
GCGAGGGTGCCGACGATGAGGACGAAGAGGAGGAAGAGCAGGACGAGTCCAAGGAGCTGGGGCTCGTGAACGCGTGCCACTACCCCGTCAAGAAGGCCGA
GAACTGGTGGGTGGTGCTTGGCGACTCCAAAAAGAACACGCTGCTGAGCATCAAGCGCGTGCCGTTCGCGAGTGCGCGGGCGAACGTGGCGCTGCAGTTC
GCCGCTCCGGACGAGATCGGCTCGCACACTTTCCAGCTCTACGTGATCTGCGATGGCTACGCTGGTTGCGATCTCGAGAACGAGGTCAAGATTTCTGTTG
TCCAGGGAGAAGACACAGACGAAGAGGAGGAAGAGGACGATGACGACGAGTAGTCTACCTCATGGGCACGCATACACTCCAAGGTAAAGGATCAACCAAA
ACATAAACATTCATTTTATATCTGCCAATTTGTAGTTTGCTGTTC