Description :
From Genome Similarity Track
Location :
Scaffold_1:2761435- 2773176
Transcript NameFunction/comments
Phyin_T30-4PITG_00524Putative uncharacterized protein
Phyin_T30-4PITG_00525Protein kinase%2C putative
Phyin_T30-4PITG_00526Putative uncharacterized protein
Phyin_T30-4PITG_00527Luminal-binding protein 3

Sequence
11741 bases(100 bases per row)
AAGGCTCTCTAATTAATTATTGACGGAGTGTTACGCTCGCTAGGTAGGACTTGATAAGGGACTTAAATGCGTCCTGCCTGGAGCCCCCATTATTCTCAAC
ACGCCTGCCTTTTCTCTTTGTTTCCCACATCACCACATGCAAATACCTTCGCGGACCTCTCTCACGCAAATGGCGACGTTGTTCGCGTCTTCTTGTCAGA
GATCCAGATGCGCAACTTCTCTAAGTTCTCGATAGGTCCATCGTGTTCTTCTTCATCTCCACTCCCAAATGCGCCTGCACTCATTCGATCTACACTCGCA
CGACACGCGGCGTTGATTTGGTCCGCTTCGTCCGGCAACCACTCGATATTCACCTCAATGTCGGTTCTGTTCGACACCAGCGGCATCAAATACGACACGA
ATCGCTGTCGAGCCGTGGGCGGAAGAGACGGGATCTCGATGCCACGTACTGTGATCTTGGCCGCAGCCGTTCCGACTACAATATTAGCAATCCATTCGCC
CAAATACTCAAACTTATCAGGTCGTCCCTTACAAATATCGCGGCGAAGTGACAGGAGAAACTCCTGTGTGAAGTGCTTGCACTTCTTCTGTAATTTATAC
TGCACGATGGCCTCGCTCAGCGCCTGCATCTGCTCCGTATTCTCCATGCCATGTGTACCCAAGTCGTAGCACTCGTTGCACAAGTTGTAATTTGAGCATA
CACTGCACGTCCAAAGCGCCCCCACAACCGGGTCCATGCCACAGCCATCACAGAACGAGTTCTGATGCACGATTGTTTTCTTGCGCTTCCACTTGGAGCC
AATAATGGACGCTCCCTGACTCATAGCAGCTCCAAGACGTCCCATAAGTGGCTTTCCAGGCGAGTGTTTCTTATCCGGCAGGCTTTTCGACTGCGCGCCT
TCTTTGTCATGTACGTCTCTCTGGAACACGAGAGTACGCGGCACTGTCGACGTCTGAATGATCTCAAGCACTTGCTCCTTCGTCATGTGTGGCTCAATGT
GCTGGCTGTTCACACTGATAAGATAGTCGCCTACTACCACTCCACCACGTTGTGCAGGGCTCTCTTTCTCCACACTCTCGACTTCGACCAATAGCTCGTT
CTCCAACGACACAACCACGTTCGTGTTGAAGCCCAATACTGGCTCTGTAAACGTCAACGTGTATGTGTTGAGAGGGTGCTCCACAAAGTCTACTTCAGAC
TGCGAGCGCAGTCCAGACTTGAGGTCTGGAGCGTGGATCGCGCTGGCACTTGACGAGTTCCGTCCTGACGACTCGCCGCTGCTTGTTACACTTCCTGAGC
TCGCTACGGCCACTGTTGCCTCGCTAACGAAGCGCGGAGGTTTATTATGAAGAGAAACGCGACGTAAGCTGTGCAACGCACGAAGTGACGACGGGTCGGA
AGCCACGCTCGGGCCCAAGAAGCGATGAGAAGTGAACTCGTCTTGACCTTCACCAAAGTCCGCAGCACCGCCGTAGCCCAAAGGTGTGCCTAGATCGGCT
CCTTCGTCGTCGTCTTCACCTCCAGCAGCTCCTTCCTGATCATCGCTGTCACTCGCCTCGTCGATAATATCGTGATGCACTAAGTTCAGCGGAGACGGAC
GTTTTGGCGACGGGATCACTAGCTCCACCTCGTGGCCACAAACCTCGTCGTCCTGTACTTTTAGCTCAACTTCATGAACCTGCATCTGTAGTTTTTCCAC
TTGTTCAATGCCAACAGTAGACGAGGATGGCGACGGCGGGGAATCCGAAACCGCATCCTGTACAATCAGCTCCTTTTCCTTTACATCTTCTCCGAATGTA
TGCTCAGGGGGTTGATCTACAGGTGTCGTTGGCTCTGAGTAGGTCTCCACGGGCGTTGTGGGCTCTGAGTGTGTTCCTGTGGGGGTTGTTGGCTCTTCAG
CTGGAGTCTTTGGGGCGTCCACGGGTGTCGTGGGCTCCTGAGCGGGTGCTACTACATCCTGCTGCTGCTTCAGTGGCGGCTCCTCGTCTTCGTCGTCGCT
GTCTGTCCGCGCCTTGTCGGACTCGGCGCCGTCCTCGTGTGGTTTTAGCTCCAGCTGCGCTGCAACGGGACTCTTCTCCGTTTCCACCTCAACCACGTCG
TTCTCGGTGGGGGTGGAAGGGCTTATCGCGGCTGCTGTGGGCTCTTCAGTAGCACGAGTTGACTCCGCGTGTAGCTTCACGGGCGACGCAGCGGTAGCCG
ACGCCTCCATCTTCTGACTCCTGCACGGTGTAACGTATTGTGGAGAGCCACTTGCGTTTAGTAAGGAGGTTCTGTCGTCCTTACGCTTTTTTCAAGTTCG
AGAAACTGGATACCTGCTTATTCGAGTATATCAGAAATAACTGTCAATCTGAGGCAGGGTTTTCTTACATAACTTAACTGAGATAGGTGATAGAATGCTA
TACATTGAAGATATAGGATTTCGAAGACATGGTTCCGTAATTTTTGAGTGAAAAACGTGCTACAACCGTCGTTTTCGCTTCAATACACCACGGTTTAGCA
CAGCGTCAAGCTAAGCATCTGTCCGACATCGCATGGCGAGGGAGAAGTGTCGAGTCGACGTGGACACGAGCAGCACCGCTGACTAGCATACGTTCTCGCT
GACGTTTGGGAAGGCGGTTGTTGTCCAAATGTGTGCAATATTTACAGGGCGTATCCGATAACGAATCGGTAAAATTGCGCAAAACAACTCGGTGGCTCAC
TGTTGACGCAGTAAGAACTGCCAATCGCTGTGTTAAATTCGATGTTAGCTTCAACTTGTTCGTTTGATTCAGTACATTTCTTAGCAACTCAAATAGGTCA
TTTAAGCCGTCGGAACAGCTCAGCTACTTCACATGCCGCTGCAAATTCACCCTCGCAGAGTGGATCGCCACATTTTGTTTCGTGAAGTAAGCACTGAGCA
ATGGTTTAGCTCTTCGTGTGCTGTTGTTGCTGCTGCATCAAGGCACAGAACTCATCGTAGTCGATCTTCCCGTCCTCGTTCTTGTCTGCCGCTTGGATAA
TTTTGCAGGTTTCCTCGTTGTTGATGTGCTTATTGCCAAGCACATGGAGGATGTGCTCGAGTTCGCTACTGGAGATAAATCCGTCATGATTCACATCAAA
GGTCTACACAACACACCACGTTGCAGTGAGTGAGGATATCGCCACTGATAATTGCAATACGTACATCGAAAGCTGCTTTGAGATCTCCAGTCGTCAGATC
CCCGCTACAATGGATAAACGTCAGTTTCATTAGTGGCAAACATCGACGAAAACCGAGATCGTGTTCGTACCGACGGAATAGTCGGTCGTTCATCATACTA
ACAAACTCAGTGAACGAAATCTTCCCATCACCGTCAGTGTCTGCTTGGTGCATGATCTCATCAATTTCAGAACTTCAATCAGCCAACAGAGAGTTAGCAC
AGGTGTGTTACAGTACTAACATTAAGAGCGAGAGCCAAACCTTGAAAGCTGCTGTCCCAGTGCTAAGAGCATGCCCTTCAGCTCCTCTTGGTCGATGCAG
CCTGATTCGTCTTTGTCGAAAAGAGAAAACGTCTCCTTGAACATGTCCATATTCACGGTCGCTGTGCGGCGAGACGTGAGTCGCTTTTCATCGGCATCAG
AAGTTTTACCCAGTTTCGCGTGCTGCACACCCATGACGACTGCCAAAATGTTGGCTCGAAGTTGCTGCAAGCGCTGATACGATTGTAGTCGCTGGGTGTA
GCAGCTGTCGAGGGGCTCCGCAGACGTCGTGATGCCACTCAGCCATGAATGCTGCAGTGCCTGCTTGGCAGTTAACCGTTTGGCAGGGTCGGAATCTAAT
AATCGCGTCAAGAAATCCTTCGCTTCTGCAGTCAGATTCTTGTACCAATTGTTCTCCACTGCATAAAAACAGTCGCCACACAATACGTAAGGGTAAAATT
CCAATCCAAACCAAGAGGCAATGGACTTTACCGTCGTAATTTCCATTTGCGATCTCCTTTACGATTTCCGCGTCCGACTTGTCACCTCGTGGGTCATATG
GGTGCACTCCTGTGAGGGTGATATAGGCCTGGAGCAGGATCAAAAGCGACGTGGTAAGTTTTCCTGCAACAAGATGGTGGAAACCAGAGTAAAGCTTTCA
TACGAGAACGCCGAAAGCCCACATGTCAACGCCGAAGTCTTGAGGCTGGCGTTTTATGATCTCAGGAGCCCAATACGCGCTACACAAAAACAAAGTAAGT
CGCCAACTTAAGCCGTCAGAACTTTAGTGCATGCTTACACTGTCCCATTCCACTATCTGGTCTCCCTGTCGTTGTCGCCGACTCAATCCAAAGTCCTAAC
GTTGCGAGAGTAAGTCAATGATTTCTCCTACAGATGCCGCAAAAGGAAACTCACTCACCGCTAGTTTGACGTTCGCCTTGGCAGAGCGATCTGACAGCAA
AACATTCTCTGGCTTTAGATCGCGGTGGCTACGAAATGCAGTTTCAACCCGTGTAACAACTCAATATGACGCCATTCATGCAGCGTGAAAGCCTACCAGA
CACCACGGGAGTGCACGTAGTCTAGAGCCTGACAGACATCATGCAGTAGATGAGCAGCGTCTTGCTCTGAAACAGATCCCTAGTTTCACAACACATGATC
ATGTTAGTCAGCGAGTTGTCCAGTTCTAAGCACGAAAAACAATACTACCCAACCGCACCATATCGACAATGTAGTCAAAAAGCTCTCCTCCTTCAACCAA
ATCCGTCAGCATAACAGTTTCATCCTTCAGATACAGGACATCGTGCAGCGACACAATGTTTCGGTGCACGCCAAGATACCGCAGAATATCAATCTGCAGT
AAGGAAAAACAAATACTATTTAAAGCATGCACCCAGAATGTCATTTATCCACAATAAACCTGCACCTCGGCCTGAATCGTCTCCATCGACGAGCTTTTCG
GATCAAAAATCTTTGCGGCCAGCATCTACGAATCAATAAGCAAAACTCATCAGATACTGTCGTCACACGAGCTCATTTACTACATGTAGTGTTGCCAACC
TGTTTAGTCTCTGTGTCGAACGCAAGACGCACAATGGAAAATCCTTCACACTCAAATAGAAATTAAAAGCCTTTCCTTTAGCAAACTCTTCCAGAAAGCA
TCCAAACCTCCTCGACCAAGCTCTTTTAGCAGCGTATAGTGTCCTCGTTGCTCCAGCTTAGGGCTTGCCCACCAGGATTCACTCCTTGACCCACATTCGA
CGTCGCTGCTTGGCGCATCTCGATGCATCAGGATAGCGACCCCCAAGGCCGCCGCCGTCGTCACAAAGCCCACCCAACCCGTTCCATTGCTGTACGACGC
TTCTTTTGGCTTGGGAGGTGGAAGATGCTGCACTGCCGACGTCGGCGTCGCCTTTGAACGTACCGGCGCGCGCGTAAGAAGACGCATGCGCATGGTTAAC
CTCTCGTTGTCATAAACTGAACTGATACTGAAATTTCAAGTGGAAAAATTGAAGTGGTGATTAAGTAAGCATAAAGTAACAAAATGTTGAAGTTGAAGTC
ACTCATCAACGAGCATTATTCCGCGGCGTGTATGGGTTCACCTCCTCCTCGAACAGGTCGGAGGCGAGCTTAGACAGCGCGTGCATGGCCTTGAGGTCCT
CCAGCGAGATCTTTTCGCGGGCTTTGGCGTCTACTGTGCACAAACAGGCAACAACAACGCCGTCAGGTGATTTGATGGGGAAACCAGCGAAGAAGCGCAC
GCCGATGTCGCGAACAAGTCGCAGATGACGTAGCTGTGCGTCACGCGCAGGATCTTTAATCACGAAAGGCTTGCCATTAGCTACGAGAGGGAACGGACAA
ACCGTCATCTCTTCGGTCCATGGACGCGGAGCACCGGAAGATCCCACAATGCGCTGAGCGTGGGAGTTCATGGCGTTAATCGCCACAATGTACGCGATTG
AACAACGCATGCGGATGGCAGCAACCTCGCAGACTGAATCCAGCGCTGCCGAGTTCAGGTCATCGTCCAAGTCAAGCTCCGTCTCCAGATTCGTCGCCGT
GGTCCATGGTCGCGGCAGGACCGTAGGTCGGACGAACGACGATGAGCATTGACCGCTAGTACTACATCGTCGACGCTGTGTCACTTCTTGGAGGTTGTAG
AACGAACTTGATTGACTGCGAGAAGCGTCGCTGCTGCTGTATGCGACTGTAGGCTCGCCACTGAGCGATATACTCGATAGATGCAGACGAGCCTCCAGAT
ACTTATCCACCATTTTCCTGTCCGGATACTGCGAATGAAACACCGGAATCGACGGGTTCAACGTCGAAGAGGACGAAACTGTAGAATTTGAGTTCGTTGG
TGCCGAATCGGATGTCACCTGCTTCACCACTTGGCGCACAACTTCCAATGCCCGCGCCCTGGTCAGGGGGTCACTTGAAAACAGTGCGTCGGCCAGTTGC
CGTCCAGGTGTGGATGAAAATGACGTCGAAACGGTAGCTGCACTGCTGCTGCGGTCCAGTCGGTGCATTTGTGCCTCGTACGCCTGTGAAGTTGATGCCT
TCTGGGTTGATTGTGATGTACGAGAGTGGTCGTTGTTGAGCAGGATATTGTAGAAGGCGGTGGAAATCTTCGCACCTATTTCTTCTTCGTCCTCTCGGTT
ATTCGTCCTGGCTTCTGCAATCGAAGCTCTAGGAAGCGATGTGTTTAGCAGCGGGTTTTCTTGTTGGAACACGCTGGCATCCACGTTGGCCACACAAGCG
AAACAAATTCGATTGCGTCGCACACTGCGTGCTACTGGCTCCACGTCAAACTTTCTCGAACATTCGCGGCAGACACGCTGTGCACAGAGCTGGCAGTACC
GCTGAGAGCGTAACAGTCCAAAGTTCTTTCGACACACGCTGCATCGATTGTCCTGGGTTGTGTGGTGGACTGCAGGCATGTGGAGGAATGGCTGGTACCC
CAACCGACGACGACGCACGAGCTGCTCAAATGACGTTGTCGCTGCAGCTAGGGTATTCACGACGTACTTGGCTTCAGCATTGGCTGTCGGTACTGCATAG
TGTCGTCGAGAGGAAACCGAGCCAACACCAGGCTGGCCTTTAGCCCAGAACCTCGGACGCACCCGTGATGGATCGGTGGCTGGACTGTAGACGTACGCAG
TCATCGTGATCCGTGTCTGATGCCCATTCAAGTCGCTGTACGAGCTCATGAGGTGATAGCCGGCAGCAATGTGGTCCATATCGCCTCGAAGCGCCTGCTC
TGACGCACGCTGGTCTCTACAGCCAGTGAACTTATCGTGCATAGGCTTGGGTAGAGTCTTCATGGTGTAGAACGCCTCGTTAGCATCAGGACAGAGCTGC
GAATACGCCGCAAAGCAAAGTCTCTGGCGACGACTCGTGTGCTTAGCTGCTGCCATTGGGTTCAAAGATCGACGCGAACGTAGCACCACGGATTGCAGCG
CAACCCAGCCAGGTTGACACAGATCGTTCAGGTCTTCGTCTTCCCAACAAGGCGAGCTGTCGTCTCCGAAATCCATCGCGAGATTCTTGCGGAACTCGCG
TGAGACCAGTAGATCACCGCTCTTGTACTTCCTGGCACCGAATAGAGCGTCCATGCTTGCATCGAACTGTAGTGTCTCGCGGCTGAACAGCATCGTCATC
GCTTCCCCTAGTCTGCAGTTCAGTGTGACTTGAGCTGATGCAGCGTAGGTGACGTTGAGATCATTTAGTGGCCATTGTAGCAGCTCTCTCGCTCGAATTT
CGGACTGAGTGTGCTCTCCGAGGAACGCATTGCGCGTGTAGATGGAGCCGCGGGACTCGATCATGGAGTGGCGCGTGTCGGCGACTCGCGTCGATCCTCG
AAACCAGTTGGGGCCTTCCGTGCTTCTTACCGACGAAAGTTTGGCTCGATCGAACTCACTGATCTCAGCGCCGTGCTGCTTCTTCTTAACGACCCAACAC
GGCGGTTGCTGTCTGTCTGACGGTGCCATTTGCCACACACTACTGGTGCGGAACATGTCCTTTCGGTGTTCTACAACAGATCGAAGCTTGGGTACGACAC
TCGCCGCTGTGGTGAACAGCTCGCGGTCGGTCACGAGCGCGTTGATAGACGACGCAGACAGCAGAGCGTTGCGAGCCGACACAGGCGACGCTGCGCTGTT
GTTACGACTCTGGAAGTCGCAGCTACGGATGCTGCCTCGACAACTGCTACCCAAGTAGCTGTCTGTCATTGAGGCTGGTTATGCTGGTTTGCGTACTGAG
CCACGTGGTTGGTGTCGTCGGCGTTGTGAATTGAAAAGTGAGGACGGCAAAACCACCGAGCACAATGTTGATGCAGCCATTTCCTTTCATGTCGAAGAGC
TCCGTAAGCTGTAGCGACGTCCATCGGAGCAGGAGAGGTGCTCCGTTGTCGACGGCACCGGATGCCTGGCGCTCTTGCTGGCTTGATGCAGAGTGTCTGA
CTTGTACGCAAGCTCTAAGCAACACCTTTTTCGGAGTTGGTCCCCAGAGTAATTATTTCGATGATATTTGTTGAAGTTGTCTCGGTGTTTCTGAACTCTC
ATTGCCAGTAATCACATTGTTGCCTTTGAATCCAAACTTTAGACGGCCTCGAATCTTCATGCCTTTCTCCTTAGAAGTCAAGTGGTTGGGTGGGTTCTCG
TAGTCTCCGATAGCTTACTGTCGGACAGTGTCGACTTCTGCAATTCCATGCCCACTGTCAGCATCCATCATCGATGTCAAGACCAGTTGAGCTATGTTGT
ACGGTACACCTAGCGGGTCATGTGTAGCAGTGGAGACGACCACGAGTGTCCGCGTGGGTCTTTCGACCGGGGCCTGACTTCGGCTTCCGTTGCCTTTACT
GTGACTTCGGTGGCGCGCACGCATGCCCCGTACATCATCTCCTGTCCAACACTTATCGCTGCTTGGGTGCTGCGTTCGTCGTGAGATCGTTGCCGGCCAC
TCGTCCATCTGGGTCTCCGCCCGCACCGAAGTCGAACCCCACGACCAGTCATCAAGTTAAAAGTTGCTGATATTTCACCACACTACCGACAACGGGCGGC
CGGCAACAACAAAAGTTGCATCAACCGGAGCAAACGAGTTGCAAAAATGTAAGGAAAAATCACCTTGTACTTAAGAAATAACGAGACAACAAACTTTTCC
AAATGCATTCTGCGATCCGGGTGTGTGCGTCTACAGCTCGTCGTGCTCGTCGTCGTCGTCGTCCTCGTCGTCCTCCTCCGGGGCAGCGCCGCCCTGGTAG
ACCTTGGACATGATGGGGTTGACGAGCTTCTCGACCTCCTTCTGCTTGGCCTCGAAGTCCTCCTTGTCGGCCTCCTGGTTGTCCTCCAACCAGTCCATGG
CGTCCTGCACAGCAGTGAGCACCGTGTCCTTGTCGTCCTCGTCGATCTTGTCCTCGAGCTTCTCCTCGACGTTGTTCTTCAGGCTGTACAGGTATCCCTC
GAGGCCGTTGCGGCCATCGATACGGTCCTTGACCCTCTTGTCCTCGTCAGCGAACTCAGCGGCCTCCTGGACCATGCGGTCGATCTCTTCCTGGGACAGA
CGGCCCTTCTCGGCAGTGATCGTGATCGTCTCGGCCTTGCCCGTGCCCTTGTCCTCAGCAGACACTTGCAGGATACCGTTAGCGTCAATCTCGAACGTCA
CTTCAATCTGGGGCACACCACGCGGGGCAGGGGGCAAACCCGTGAGCTCGAACTTGCCAAGAAGACGGTTGTCCTTGGTCATAGCACGCTCACCCTCAAA
CACCTGGATCAACACAGCAGGCTGGTTGTCCTGGTACGTGGAGAAGGTCTGCGACTTCTTGGTCGGGATGACAGTGTTACGGTTGATAAGCTTGGTCATG
ACGCCACCCACAGTCTCAATACCCTGGGACAGAGGCACCACATCAATAAGAAGCACGTCCTTGGTCAGGTCGTCCTGCTCGCCACCCAAGATACCGCCCT
GGACAGCAGCACCGTAAGCGACAGCCTCGTCGGGGTTCACACCCCGCGAAGGCTCCTTGCCGTTGAAGTAGTCCTTGATCAGCTGCTGCACCTTGGGGAT
ACGCGTAGAGCCACCGACCAGCACGATCTCGTCGACCTCCGACTTCTTGAGGTCAGCGTCCTTCATCACCTTCTCCACAGGGCCCAAGGTCTTCTTGAAC
AAGTCCTCGTTAAGCTTCTCGAAACGAGCACGGCTCAGAGACTCAGTGAAGTCCTCACCGTCCAGAAGAGACTCAATCTCAAGACGAGCCTGAGCCTGAG
CAGACAGAGCACGCTTGACACGCTCAGCCTCACGACGGAGCTTCTGCAGAGCACGCTTGTCCGAAGCCACGTCGATCTTCTTGTCCTTCTTCCACTTCTT
GATGAAGTACTGCATGATACGCTGGTCGAAGTCCTCGCCACCCAAGTGAGTGTCTCCGTTGGTGGCCAGCACCTCGAACACACCGCCGTCAATGGCCAGC
AGCGTCACATCGAAGGTACCGCCGCCCAGGTCGAACACCAACACGTTCTTCTCGCCCTGTGCCTTCTTATCAATACCGTAGGCAATGGCAGCAGCCGTGG
GCTCGTTAATGATACGCTGGACCGTAAGACCAGCAATAGTACCGGCGTCCTTGGTAGCCTGACGCTGGGCGTCGTTGAAGTAAGCGGGCACCGTCACAAC
GGCGTCGAACACCTCGCGACCGATGTAGCCCTCCGAGATCTGCTTCATCTTGGTGAGCACCATGGCCGACACCTCTTCGGGAGCGAACTGGCGCTTCTCG
CCCTTAACTTCCACTTCAATGAAAGGCTTGCCGTCCTTGTTTACAAGCTCGTACGGCAGCAGCTTCTTGTCAGCCTGCACCGACTTGTCGTTGTACTTGC
GGCCAATGAGACGCTTGACATCGAACAGCGTCTTCTCCGGGTTGATAGTGGCCTGGTTCTTGGCACCGTCACCGATCAGACGCTCGTCGTTCGAGTCCCA
AGCGACATACGAGGGCGTGATACGGTTACCCTGGTCGTTCGCGATGATCTCCACTTTCTGGTCCTTGTAGATGCCCACGCACGAGTACGTCGTGCCCAGG
TCAATGCCGATCACGGGGCCGCGCGGACCCTTGGTGTCGTCGGCCACCACGGCGCCGACGAAGGCCGCCGCCGCCATGAGGATTATCTTCGAGAGGTTCA
TCCTTCTCTGTGTGCTTAGCTTCTCGTTGGCGAAAACGATAATGACATGCTAATAAGCATGAGGTGCACGTGGAAGTCAAAGATCGAAGTGCTTCGAATA
CAGGGCAGCATACAAATGGAAAGAGAAATGCCGTGCTGACGTGGCTTGGGGCGGGTTTCTAGAAAACGGGTCTTCTAGAAACCCGCTTAGAATTCACTGC
AAATTTGTAGGACGCTTATTGAAAACAAGTGAGCGTTTGCCACGCGTCGTTGTTGCTCGGGTAAGTGCGAAGATATGTTGTTGTTGGACGACACACGCTC
TACCATGAACAGGTTAATGAAGTACGTGTTCAGTCCCACACGAACAGATCGAGAACACTCGTGTGGTGGTTTTTATCATAGGTGTCGGCTAAGGGCTGTT
ACGTGTTGCGTAGGGCGAGCTTGCAGGCAGGATTGCATACTTGCAGAGCTATTATATTAATAGTTGCTTTATCGCCACGCGGTCGATTCGCACTTAGCTG
AGGGCAACTCTCCACGTGGCATGAGGACAAAGCGGTATAGATTTGCAATAGCACGTGGAGCTGAAGAAGCTGGGGTAGAGTCTTAATCTGAGTTGGCATG
GACAAGCAATGCGCTAGTCGATCCGTAGAAAATGTGAAGGC