Description :
From Genome Similarity Track
Location :
Scaffold_70:276138- 279109
Transcript NameFunction/comments
Physo_139132hypothetical protein

Sequence
2971 bases(100 bases per row)
ATCCACTCACTCTTGGTCTTCATCATGTCTAGGCACCGGCCTAGAACCTTGTTGACCGCCGGAGTATCGCCGTTGAGGGGAGGGCGAGTGCCAACCGGCT
TGGAGGATACCCCTCCTACCGTCACCGATGGTTTGAAGCCCTCGGTTGCATCGTCATCTGCGTCGTAGGCAGGCTCGGGGCCCGGCATGGCATTGAAGAT
TTCGGAGAGGTCGCGGGTGATCGACCTCGACCCTCCACTGCGACCTGCTGACACAATCGCAGCTTCCGAACCCTCGGACATCACAGTCCTGACATTCCAG
TCATCATCTTCTTCATCTTCCTTGGCGTCCGAGAAATCAATCGCCATGTTGTAGCTCGCCGAACGCTCGTCGATCGACTCCATCCGATCCGTCGCTGAGG
TCGAGAACGAGCTTCCGGGGCGCACCGAAAGCTCGTTGCGCGTTCCACTCGACTTGGCCGGCGTCGCTGGTATCGCTGACTTGACTACCTTCGCCATCTT
CCCTCTTCTTCTGCTTCGCTTCTTCTCCTCTTCGCTCGTTGGGGGTAAGACCTACAACAACCAAGACACACAGAAGGCCACACCAATCCCGGGTCGCGGC
ACCAGTTGTGGTGTGGTAATACCACTAAATTCTCTTCTACGAAAAGGACACCAACAACACGCTAACCCGCAAAGGTAAGCGCTTATTGGATCTAAACCTG
AAGACCAGGAACGATCCCTTACACCGGGTCGGTTGGAAGCGCCTCTGTGCAACTTAGGTTGTCTTCGGTCAACCCAAAAACCTGTACCACTAGCCACGAG
CTTAGGCTAGGATACTATGTAGCGCTTTCGCGCAACCCCACTGCAGTCCCTCAGAAAGGAAGGGTACCAAGGTAAAACCTCGGTAGGTAGACTGATACAC
TCAGGGACACTCTAATCCCACAAATATATATCGAACGATACTCTAATACCGTTCCTGCCTCTCCGACCACGCCAACTCTTGGCGCCGCCAAGGAAACGCT
CGGTCAATTCACGATTAGCTCCCCGACAGGCATCCACACGCAGCCGAGCGTGTCCAGGCACTACAATAAGCTAGCTACACTTAACGAAGTCGGACTTGAC
CCTTGTTGGCTTTGGAGGAAGACTGTCTTTTTATTACTGCGTTTGTGAGGCTCTAGGAGCCTCGTTCTGGTCATACTTTGACTAGTCCTATGTCTCGATA
CAAATATCAAGTGTGAACGATCGCAATGAGGCGATCCTGGACACACCAAATGACACACTAATAGGTGCGGCCGAAGTACGCGACTAAATGCATCTGTACT
AAAACCTGGGCACTATGAAGCCTCGTCCGGGGTTGTATTATGACCCGACGAGGCTCCTGCCACTATCTATCACTCTACCGGGGATAATGGCGTTGACCAA
TCCAAAGTAGCCGTCACCGTCTCTCGCCTGAATGCTCCTTGATCGCCCTTGATAGAGCTTGATTATTGGCAGGCGGGGCGATCTCCTTTGGAAACAGTCA
TATTCCAATACCACAGACGCTTGCTCGCGTGACCGTTGTTTATCACGGTGTAGGATGCAAAACAGGTATATCCCCGAACCATTTGCTCCCACCCTATGTG
GGACGAAAAAGTGTTAATGTGGGAATTTTCAAGATTTCTCCACTTTTGACGTGGTCTGGACATTGCTCCCCAAAATCGCATACCATTTCCTCAGCAAGTT
AAGTAGCAGTTTTCAATTCTGACACCCCTTTTTCGATCTTTATTGTTCACCCAAACACAAAATGTATAGTAACACTACCGCCTTCCCTCGTACTAGACGC
CTAGGTGTTGTATTCGAGGTTGGTCAACAATCCCGAATCTGATCGCACCCTCGAATTGAAGCAATAGCAAAATAGAACGCCTACCCAAGCGTAACACAAC
TCTTATTAACGTTAGTAGTTGCCAACAATTCTGCTGCCATTTGGACGAGGTAGCACCTCTGTGCCGACCGCCAGCCATACGAGCGGAAGTCGAGCTCTTG
TTTTGTCGTATCATTATACAATCGCCCTCCCGCGACACAAAAGCCCACGCCAAGAATGTCAGCCCAAGAAAAAGCGTAATAGCTACAGTATCGGATTCAA
GCGCAGTGTTGCTGGAGAGTACAACAAGGGTGTCGACGGCTTTGGGTTTGCCGCCCTTGTCGCAAAACTCAAGATACCCGCGCTGTCGATAGGGTTGAGC
AGCTGGGCGCCTTAGAGGCCACTACCAACCTTCAGGGATTTTAGATTTACTTGAATACAACGCCTACCTTTTGCATCCTTCAGAGTTTCGCAGTTTCACT
TGAATATAACGCCTAGGCCTTTTATTCAAATATAACGCCCACTAGGCGTCCAGTACGAGGGAAGACGGTAGCGTTTGTTAACCGTTTGTTAGTGTATAGT
GAATCTGGCTAGCATGTATATGGAGTGAACCGTGTAGTCGTTCATCTTGAAGATGTCTTAAGTCACTTACAGTGAGTTAGTGTTATTGTAAAAGTCCTTA
CGTGTTTGGGGTATACTGCTGGTCTCGATGATTCGATGAACTTTAAATTAATGTAATGTAAGAACAGATGTGCATATGGTCGTTGAATGTAATGTGACTG
AGCTGTTCGTCATGCGTTACAATTCTACTGTTATCTTGGCATTGCTGAAGGCTCGAGAACAATTTAGCCTGGCACCGTGGCCGCAACGATATGTATACCA
GAAAATACAAGTTTCGCACGAAGTAGGATGCTTTCAATGCAGTCATCGACTATACCCTTTTTAACCCTTCTAGCCCCAGATCTTATCCTGTATCCTACAG
AATAAGCATTAGACTTGATTAAAGTATACTTCAAAACCTGTCAAAGATTTGCTGTTGGAAGCCCTTTCGCATCTTGCGGTCAAGCGCTGGGTACATTGGG
CACAGAACAGCTACGAAAGTGAACAAAACGTGCTCAATGTATCCATCATATGCCGAAATGGCGAGCTTCTA