Description :
From Genome Similarity Track
Location :
contig_50:276131- 282877
Transcript NameFunction/comments
g9923.t1ETK78359.1 hypothetical protein L915_15595, partial [Phytophthora parasitica

Sequence
6746 bases(100 bases per row)
GCAGGGATGGCCATGACGCCCGGTGGCAAGATGGACCGCCGCCGCGCCGGCTCCAACTACTTCCAGCTCGACGCGGACCGCAAGCGCAACACGTCGGCCA
ACCGGTCGCACCTGAACGGGGACGGGCGCGGCACGTTCGGCGACCGGCTCAGCATGATGGACGTGCTGCCGCCCACGACGCACGGGGGCAACCAGCTGCG
CGGCGGCGGCCTCGAGGGCGACTTCGCGGACGAAGTGTCGGTGGACTTCTGCTGCGAGGTGCTGTACAACAAGTTCGGCTTCCAGTCGGGCTCGGTAGAC
AACCAGCGCGAGCACGTGCTGCTGCTACTGGCCAACGCCAAGGCGCGCTCCAAGCCGCAGGACCCGCCGGGCCACCACGTCGTGACGCTGCACAAGAAGC
TCATGAGCAACTACACCGAGTGGTGCCAGTTCATCGGCGCGGGGAGCGTCACGTACACGGGACAGGCCCAAGGAGACCTCAAGAACCCGCTGCATATGGA
CATTATGCTCTTCCTTCTGCTATGGGGGGAGGCTGCCAATCTGCGGCACATGCCCGAGTCTCTCTGCTACCTGTACCACCAGGCGGTCAATATGCTCAAC
CAGGACTTCCTCGGACAGCAAAAAGTACCCGAAGGATGGTACCTCAGACAGGTGGTGCGTCCTATTTGGAAGGAGGCCAGCAACATGCAGCGGAAGAACA
GCTTGGGCAAGAACTTGGAGCATACGCAGGTGCGCAACTACGACGACATCAACGAGTACTTTTGGAAAAAGTACTGTTTGAATGTGGATATCACCCACAT
TGGCGAGGAACTGACCAAGAAGCACACCAAGACGTACTACGAGCACCGTAGTATTTTCACGCTCGTGCTCAACTACTACCGCATTTTCCAGTTCAACATG
ATGTTCATGATGGTGCTCATGGCTATTGGCTTCATCTCGGCCATCTCGCCCAGTGGCGGCCAGCAGTGGTTTGCCCAGTTTGGCTCCATGGGCGAGGTGG
TGGAGCCCTACCAGCAGCAGGACGTCAAGCTCACGTACGTGGGGATTGTGTGCGCGCTCTCCACCATGGGATTCTGCAAGACCGTCTTAGAGGCGTGTCA
CGGATGGCATTTGCTCACAGCCAGCGAGGCTTCCGCTACGTCGTCACGGTCGTTCAACTACGGAAGTGCACTGGTTGTTCGTATGCTCTGGAACGGAGCG
TTCGCTGGCATCTTCGGGTTGATGATTTACACTCCACTCATCACGAGCAAGAACACTGAGCTGCTGGACAAGGCTGCTCCAGCGTCAATTGCCTACATTA
TGCCTGGCGCCTTGATCATGACTGTCCAGGCTTTTGCCCCGTCGATGGTCACCAAGACGTTCGCGGCCAAGTTCATCCGTGAAGGTGAGTCGTGCTTCGT
GGGACGCAACATGGCGCCTCCGCTCAGCTACCAGATCAAGTACATCACGTTCTGGGTGATTCTGTGGGCGCTCAAGGCGTTCGTCTCGTACTTCATCCTG
GTGCGTCCGCTGGTCTTGCCGTCGCTTGCCATCTACGAGATGGATCTCGAGTACGGTAGCAACGTTGTGTCGTTCCACAACTTCGGCGTGATCCTGGCGC
TGTGGATGCCGGTGGTGTTCATCTTCAACTACGATACCCAGATCTACTTCACGATCTTCCAGGCTACTCTCGGTGGTATCCAGGGCCTTATCATGAAGAC
AGGTGAAATTCACGGCATCAAGGAGATCACGAAGGCCTTCCGCGTCGCGCCTCAGCTTTTCGACCAGAAGGTGGTGACCAACCTCGCTCGCTCGAACGAT
GCTGCCGCCGATGGCTCTGCTGCCGCGTACCAGTCGCAGATGATGCTGCGCTTCGTGGTCGTGTGGAACGAGATCGTGAACTCGTTCCGCGAGGGAGACC
TGGTGGACGATAAGGAAGCTGCCATCCTGCAGTACGACATTCAGAGCTCCGGCGATGTGTTCGAGCCTGTATTCCTGTCTGCTGGAAAACTGGTGGAGGC
CCTCGACTACACAGTCAAGCTGGCTAAGGAGGGCAAGGGTGACTCGCAGCTTCAGGTGTACATGGTGCAGAAGGATTGCCTGTCTGCGGTGCGCAGCTTC
TTCACGGCCAGCATGTACGTGATGGAGGCTTGCTCGGCAGCGACGATGCGGACATCCTCGACGCGCTTCGCCAAATGGAGGCGATTGCTGCCAACGGTAG
CTTCATGAGCACGTTCGATGCCAAGAGCCTTGTGCAACTGCGCACTGTGTCGATGGAGTTCTTGGAGGCCGTGATGGATCTGCCTGACCCGGATGCTCAG
TCCTCGCACTTGACGACATCCAGGGTGCACACATGGGTGTCGTGCGTAACTTCGTGACGAAGATGGAGAACTTGCTCAACGCCATCCGCATTCTAGCCAA
CCGCCCTGAACTTGCTGCCAAGTTCAGCAACTCCAAGTTCTGCTCGAGCGCGAACGGCTACGTGTTTGCTGCCCGTGGTCTGGTGAACCTGTTCCACAAC
GACACGGCCATGGGTGCTGCTACCCGCGCGTACCTGCTGATGTCACTTGAGAAGGCTGATGCGATGCCGCGCGTCCCTGAGGCTCAGCGTCGTCTTGGTT
TCTTCATGAAGTCGCTTCTGATGGACATCCCGCAGCTGACTTCGGTGAAGGAGATGCATTCGTTCTCTGTCGTGACCCCATACTACAGTGAAAGTGTGCT
GATCTCGCTGTCGGAGCTGAACGATCCGCTAGTGAACCACCCAGTCTTCAAGAAGGTCGAAGAGAAGGGCAAGAACATTACGATTCTCAAGTACCTTATT
ACGATTCACCCGGAGGAGTGGGAGAACTTCTTGGAGCGTATTGATGTGGGCTCGGCTGAAGAAGCGCAGGCAAACTACCCGCTGGAGATTCGTCTCTGGG
CTTCGTACCGTGGTCAGACGCTGGCGCGTACCGTCCAGGGCATGATGCTGTACGAAGATGCCATCAAGATTCTGCACTGGCTGGAGATTGGCTCGAGCCC
CGGCAAGACGGCCGAGCAGAAGCAGGCTCAACTGGAGGACATGGTGCGCCTGAAATTCTCGTACATCTGTGCCTGTCAAGTGTACGGTAAACACCGTGCT
GACAACAAACCTCAGGCCGATGACATTGACTATCTTCTGAAGACGTACCCGAACCTGCGTGTGGCGTACGTCGACACCATTGCGTCTGACGGAGGCAAGC
AGTTCGACAGTGTGTTGATCAAGAGCGAGGGCAACGAAATTGCTGAGGTGTACCGTTACGAGCTGCCCGGCGATCCGATTCTTGGTGAGGGTAAGCCCGA
GAACCAGAACAATGCGCTTCCGTTCACACGTGGCGAGTACCTGCAGACAATTGATATGAACCAGCAGCATTACTTTGAGGAGTGTCTGAAGATGCCGCAG
CTTCTGGTGACCGCTGACCTGCACCCTTCGAAGAAAGCCAGTGTCGATTATTGGTATGCGTGAGCACATTTTCACGGGTAACGCTTCGTCGCTGTCGAAT
TCAAGTCGTGGCAGGAGCTGGTGTTCGTGACGCTGTCGCAGCGTGTGCTGGCCGACCCGCTGTACGTCCGTATGCACTACGGTCACCCTGATATTTTCGA
CAAGATTATCGCCATGCCTCGTGGTGGCGTGTCCAAGGCTAGTAAGGGTATCAACTTGTCCGAGGATGTGTTCGCCGGATTCAATGCCACGCTTCGAGGT
GGTGTGGTGACCCACGTGGAGTTCATGCAGTGTGGCAAGGGTCGTGATGTGGCGCTCTCTCAGATTTCGATGTTCGAGGGTAAGCTGGCTAACGGTGCCG
GTGAAACTGCGCTGGCGCGCGAGGCTCACCGTATGGGCCAGTTCATGGACTTCTTCCGTCTGAACTCGATGTACTACTCGCACACGGGTTTCTACTTCGC
AACGTGGATGACGATTGTGACGACCTTCGTGTACATGTACTGCAAGTGTACCTGGCTCTGGCTGGTGTGCAGCAGCAGATTGTGTACGACATGAACACAA
CTTCCGTGATTACCGAGAACATTGCCAACAACTTCGACGAACGTGTGTTCACGGACCTGAAGGCTGTGTTGAACACTCAGTTCTACATCCAAGCCGGTAC
CTTCTTGATGCTTCCGCTGATGTGCGTGTACTTCGGTGAAGGTGGTCTGGTCCGTGGTATGACGCGCTTCATCGACATGATATCACGCTCGGCCCTGCGT
TCTTCGTGTTCCAAGTCGGTACGACGATGCACTACTTCGACAACAACATCGTCACGGTGGTGCCAAGTACCAGGCCACGGGTCGTGGTTTCAAGATCTCT
CGAGAAACACTGGTGTTGCTGTACAAGGCGTACGCAAGCTCACATTACCGAAAAGCTTGGGAGCTTATTGGCTTGTGTCTCGTGTACTTGACGTTTGGTA
ACTTCTACATCTGTCAGACGGATGCCTCGGCCAACGACAACACCTTCGCGTCCGACTACTGTGATACTTCCCAGGCTTACGGTGTGCAGACGTTCTCGGT
GTGGTTCATTTCCATTCTGTGGGTTGTCGGTCCTTCCTGTTCAACAGTGATGGTCTTGACTACAGGAAAACGAAGGTGGATATCCAGCAGTGGTGTATGT
GGATGTTCGCTCCCGAAGACTTCCAGGACGACGATCCGGCAAACAAGGGCGGCTGGGTAGGCTGGTGGAAGGGCGACCTGGAGCAGCTCCACGCCTCGAA
CATGATTTCGCGTGTCACTGTCATCCTCCGAGAGTGCCGGCACTTCCTGCTGATGTTCTACGTGGCTACACTCGAGACGTCTGACGTGATGTATGTCGCC
TACTCATTCGGTGCTGCCGTTGCGACTGTCGTTCTGCTGGGTGTTTTCCATGGCATCGGTGTGGGCATGCGCTCCATGAGCCCTGTAACTCGCGCGATGA
TTTACTTAGGTACCATGACCATCTGGGTCACGGCGTACTTCTTGGCCACTAAGATTGTCTTGGACTGGAGCTTCACGTACGCAATTTCGTTGTTCTTCGC
CTACGTGGCTGCCTTGTACGGCATCAACGAGTGCTTCCGCATGTGGAGCTTCCCAGGCTCCTCGATCGCCAGCATCCCGATGTTCCAGCAGCTGCAGTTC
CTGTTCGACTTTATCTTCTGCACGGGTATGATCATCCCGCTGGTGATCTTGTCCTGCATCCCGTTCTTGAACGTTATTCAGACGCGTATGATGTACAACG
AAGGCTTCTCGAAGGTCATGTCGGCATCGTCGCAGTACGCGTTCTCGCTGGCCGCCTTCATGGGCATTCTGGGTGGTATTGGTGTTGGCTGGCTGTTCAA
CCTGCTCTCGACGCTGGAGCAGTCGGCAAGTTTTGCGAGTTATGTGGTGACGTACGACGGCGTGCTCAGTGGCAATGTTGGCGACGGCACGACCACCTTC
ATGCTGTACGGCGCCTGCGTTGTCGGCACGATTATTGCTGGCTTCTTGAACTACTTCCTCGGCCGCCGCTTGTCCATCGTTGCCGGTGGTCTGTTCAGCA
CGCTCGGTATGGTGGCTGTCAGTGCCAACGACGACCTTCGTTCAACTCTGCTCATGCCTGGCATTGGTCTGCTCGGCGCGTCTTGCGGTATCCTGCTGCC
GTCACTGGCCATCTACATCTACGAGATCTCGACCAAGGAGATGCGTGGCAAGGCTATCTTGCTGCTGGGCATCGGCTTCATTGCCGGTAGTCTGCTTGGT
GGCATTTTCGCGACTGTGAACCAGTTGGGATGGATCTGGCAGACGTTCGCTGCCTGCATCGTCATTGCGTTGGTCACTCCGGTGGTGAACGTGTTCCCCG
AGAGTCCGTACTGGGTGCTGGACCGCAAGGGCTGGGACGCGTGCGAGGCCTGCCTGGTCATTCTGCGTCGTAAGCCTGACGTGCACGACGAGCTCAAGAT
CATGCGCGAGGAAGAGACCGCTGACGAAGGTGGCTCGGGGCCGTTCAAGTTCCTGATCGGCCTGTTCCTCATGCTGGTTTCGGCGCTCACGACGGGCTTC
TTGAACGCCTTCATCAGCTACAAGGGTGCCAGCGAGTACACCGACCAGGACCAGTTGTTCGTGAACGGCATGGCGCTGCAGATCTCCGGCGCGGTCATTT
CCTTCTTCTTCATCGACAAGCTGGACCACAAGTCGATCCTGTTCGCAACGCTGATCCCCGTGGCAGGCTGCGCGGGCTTGCTTGGCTTCAACGAGTCGTC
GGATCTCCTCGGCAACCCGGAGGGCTCGGGCCTGTACGTCAGCCTGGTTGTCATGCTCATGTACTTCTTCATGGGTCTGGGTACGAGCTCGCCCCCTTGG
ACGGCGTGCGTCGGCATGTTCACGACGCGAGGTCGCGCCTCGTCGACAACGTTCCTGTTCGCGATGTTCTACTTGCCCAACCTGGGATACGTGTACATGC
ACACGCACGACTCGATGATGGCGAACGAGTACTTGTACCTGTACGCGATCGCCGGTCTCTGCGTCGTTGTACTCGTCCTGCTGCTGGGTGCTGGTACCAA
GAAGAACGGCGTCATCTCGACCAAGGCTGAAGGCGAGCGTGACCGCGAGCGTGCTGCTCGTATGCGGGCCGATCGCGCGACTCGCGCTTCTCGTACGCCA
GGTGCGCGCCAGCGGAACCTCAGCCGCGTGCGGTCCAAATCCAACGCTGGCGGCCAGCGCGGCAACGCGACGCCCGGTGCCGGCTACCAAATGTACGAAA
CACCCGCGCACGCTGCGCCGCCGCTCACGCACGCACGCGCATAAAG