Description :
From Genome Similarity Track
Location :
Scaffold_53:276067- 287311
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16101monovalent Cation:Proton Antiporter-1 (CPA1) family
Phypa_INRA-310PPTG_16102monovalent Cation:Proton Antiporter-1 (CPA1) family
Phypa_INRA-310PPTG_16103hypothetical protein
Phypa_INRA-310PPTG_16104double stranded RNA binding
Phypa_INRA-310PPTG_16105hypothetical protein
Phypa_INRA-310PPTG_16106hypothetical protein
Phypa_INRA-310PPTG_16107hypothetical protein
Phypa_INRA-310PPTG_16108hypothetical protein

Sequence
11244 bases(100 bases per row)
GCCGCATGCTTACCGCCCATGATCATAAAGAGCCCCACGAAGAGGCCGAACATGAGCGCGAAGCTGCTCTGGGACAGGATCATACAGGAGTAGCGCCCCA
GCATGTAGGACGCCATCACCAGCACGAACAGCATGAGCAGGAGCAGCACCGCGTCCTCCATGCTGACTAATTTGATGTGTTTCGGACCCAAATTGGGTGG
GATTTAGCTTCTGGCTTCTTTCGATTGGCCGTCGCGGTATGCGACATGCCCATCTAGTCAGAAAACTGGTTCGATTTGCTGAATTTGAGCACTTGGATTC
AGTATGCATAATATATGTGTGTTACACCAACAAAACCAGTAAGTTGAAGTTGTTCCTATCAAACGGCGTTCTGCGTCTGCATCTTGTCAACCTGTCCGTG
TGAATCGGTCGCCTCGTCGACAGGTAATGGGTTTGCAGGGGACTGGTGACCACCGAAAATTGGCTGCATGTACGTCGTGTCGAAGGTCTGCCAGTTTCGA
ATGAACGCGCCTGTCAGAGTCTCGCCGCGCCGAGTCGTAGAGTTTCCGTTGCGCTCACCCTCATCGTCACTGTAGTCCTCATCTCGAAACTGCGGTCGTG
ATGTGAACACGGGGTCTTCTTCCAACTCAGTCTCTTGCTCTCGCGTGGTAGCTCCCTCTGAGGGTCTTTGCGCGGCGTGCTGCTCTGAGATCCTGGAATT
CCGACGAAGCACGAAGTGACGGGTACTGCGTTGTAATACTCGAGCTCGATCCTCCTCGGAGCTTGGTTCTCCATCAGGGTTTGGCTCAGGCTCAGATTGC
CTCAATGCACTATGGTGGTTGGTGAGACGCAGCTTGGAGAGGAGCGGACCAGTTATTCCACCGATCACAATTGTCGTAAAGAGCACCACGACGAGCGTGG
TAGATTCTATAAGATGGCGGTGAGAACCATACCGACCAATGTAATTCCAGTTCTTAGCGAGCGCGAATGCGATGGAGCCACGAAGAGCAACGAACCATAT
CACGCTCATGTACTTGACTGGAATCCGGTCGGAAGACTCCCGCGACCAGTTGGAAAGTTTTAGGAGCGGGAAGATATTGAAGAAGCGAGCCACAACGCAT
GCCACCAGTGTAAGACTAATGAAGTGCCAGTCGATGTCGTCTACCCGAAGCGCAGCACCCAAACTCTTCTCTGGGTGACCGGAAAAGATCATTATCACCG
ATGTCCCCATGAACACATACACGACGTTCTCACACACAAACGAAATCGTGTGAAGCAGATGCGTAAACGCATGTCGAGCTTCACGTGAGAGCACGTTGAA
ATGGTAGTGAGCTGTCATGGTTCCTGAGAAGAACAGAGCAACAATGCCACTTAGCTTCAGACTGTCGGCCACGTAATATGTCAGCAGGCTGAAAATCAAG
CACAAACAGATCTCGTAGCTGGGGAAGAAATGCAGCGACGAGAAAACCTTGCGCTTGAGCAAGAAGGCACCGCAAAGTGTGATTGCTGCACTCACAAGCA
GCGAGCCTACAAACATTCCACTGGTGTTGACTGCTACTCGCAGCAACTGCTTCCAACTCAAATCGGTGCCAACGTCCCATTTGTGCAGTGTCTGGTACAG
CGCAATTGCCACGGCATTGTTGATCACACTCTCTCCAAACACGAGGTTGAACAGGAGCGGTGGGACGTGCAGCTTATTAAAGCACGACAACGTAGCCACC
GGATCCACAGCATTAATTAGCGTGCCGAAGAGCAGCGCCTCGACCCACGAGAGCCTCGTCACCATCTTCGACGCCCCAGCGAGGTACAGCACGCCGCCCG
TTATAGTGGCAGCCACGACAGTACCAACCACAGCCGTGCTCATGATAGCTGGGAAGTTGCGGAAGAATGCCTGCCGCTTGATGGAGAAGCCTCCTTCGTA
GATGATTGGTGGCAGCAACACATTGAAGAACAGGCTGTTGTCCAGGTCGAGATGCGTGTGCAGTGCTGTGTGTTTGTCCCCCATGATCATGAATAGCCCC
ACAACGAGGCCGAAGACCATCGCGAAGCCGCTTTGCGACACCACATTACACGAATACCGGTCCAGCACAAAGGATACCACTACCAGCACGAACAGCATGA
GCAGCAGCACCACTGCATCCTCCATCGTGTCCGCCTCGTCATCGATCTCGTGCTGCATTTTGAATTATCATGGTCGATGGGAATTACGGTAAAGAAGCCG
GAGCTATTTTTTATCGACAAATTGTAAAGAAATAGCGGTAAAATGTACCAGCTTAAGGTATGCGACGGAGCAGCTGTAGACGAAAGCCACGTCAGCACCG
CAATGCAAACACTGCTGGACATCTGCTGATTGTTTAGCGGTGTTCGAATCTCGGAGCGCGTCGAGCGCGGACACCCCCCTTCTTGAAACGCAGAATGCCC
ATGACTGCTGCCGCGATGCTGCAACCAAACCTGGACATTTATTTCGACAGGGTTAGTCTGTGGCACTCAACTCATCACTCTGTAGCTCCACCTTACCACG
TCGCGGCATAACCAGCATGCTTCTCAGGAGTCATGTAGAACTCGAGGTACGAAGCAATGCTCTTTCGGAGAGGGTTGTCTGGCGAAATTTCTCCAGCCTT
ATTCTCAACCGCTGCGAACATATCACAGAACGAATAGTTTAGGTGAACGAGTGACCAACGAGTAAGAAGAGCGTAGAACCTACCGAGGGCATCAACAATG
ACAGGCAAATCGGTTGAGGTGACGCCCATGGCATTTGACAGCTCTTCGTGGTCCAAGTAGAAGAATTGGCGATTCTCGGGATCATTGTCAGGTGTAAAAT
AGTTTTTCTACATCATGCCAAAACATCAAAACGTTAGAATTGCCACCGATAAAAAGCAAAGATACGCGTACGTACCACTTCACCATGACGAAGCACGCCG
ACAAAAGACACCTTGCCGTCCTCCTCCTTCTTGTCACGTGTCATGTGCTCATCAAGGAGCTTACGCGGAAGCCACCCTCGATTCACGATTACCGGCGTCC
TACACAACGCGATAGATCCGTAGGAGCTTTTGGTTAACACACATTCACACCGCTAACAAACATAAAACTTCATACCCATCCTCACGCTGCAACAGCGAAT
AAATGTAGCCGCCGGATTTCACTCTTGCCACTGAATCACTGGGATCCGCAGGGGCCGAGCGAGGATCTACCGAATCCAGTCATGCTGTAGTGTCAGATAA
CCAAGGAAGAATACAGCATCTCGATCAATTGACTCGTACACAAGTAGAAGGTGCTTCCAACCTTGAAGTTACCCTCAAGGCGAAGCTGACGATATTCAAT
GTCATCACTTCACCATGCCCATCCAAATAACCGAATTCGACATTAGTCTTCGTACGAAATGCCAATATCAATACGCCAATCTCACATATCATCGCTGGCT
GTTGCGTCCTTCGGCAGCTCTGCAACAGACTCGGACAGCTCCTTCGTGCGTTCATTGATCAGATCCACCTTCCAGTAGTAGCGCTGGGTCTGTAAGCATA
CCCATGGAAGAAGTGAACGTTCAGCAAGCATAACCTCCATACTATCAGCAGCGTAGCTGTCGCACCTGCCACGTCCCCAGGTAGGCGGTCGTCGCCGTCT
GCAAGCCACACCGATCATTCAAATCATTCTTTCTGGACACGCAATCGAAACTTTAAACGCACCACAGCGCCGAAGAACGCCATACCAGCGTATCGGGAAA
AATTGCTCTCATTGCCACTTGATCCTCCGGTCTTGGCCTGCGATGCCGAGGCCGCGAAGCGCCTCGTGCTCGCCGACAAGCACGGCACTGCCCGCAGCAC
TTGTCTGCCCAGCATGTTTACAAGAGGTCACCGCAATAGCAATTGGTTAAAAACCTGTCAAAACGCATCACTATTGGCCGAAAACTTATCTTGTTTTTGC
AGCGCAGATGCCAATCAAACATTTCGACCAAGATGGCTTCGGATGCAGAAGGACACGTGCTGGGCAACTTCCATGCGTACTATAGCTTCAACCCGGTGCA
CGAACGTTTGCGGTTTATGGACGTCCAGACGGCCAATGCTCTGAGACGTGCGCTGCTTGTGAAGAAGGACAAGAGTGAAGCGACGTGCACCGTGCTCGAC
GTTGGCTGCAACGAAGGTGACCTGACGATTGGCCTCTACGACGCATTGAACGGACGTGCGACTCTAGTCGATGCCAATCAGATCGACGATGTGGCCAACT
TTGACCTCAAAAACATTAGCACGCTCAATGAGCGCATGCAGAAGGAAAAGAAACAGGTGGAATACTTGATCCAGGACGAGGGCGAAACCAGCCACCGCCG
ACGCTATGTGTGCGAGCTACAGATCGACGGCAAGACGATGGGCCATGGCGAAGGCGTATCGAAGAAAGTAGCCAAGGCTAAAGCAGCCGAAGTCGCTCTA
CGCATATTGGATGGTACGGACAGCAAGATGCCAGGAAAGGAGACTTCCGACAAAAAAGTTGTCCCGGAGCTACTTTCACTAACGGAAGAGGAACTGGCAA
CGAGGAAGCCGCTCATGGTTCTCGGTGTGGATATTGACGAGGTGCTGATTGAACGTGCTGCCAAGAAGTCTGTGCTATTGACAGAGGAAGACGCAGTGCA
GTTTCGCCACGTTGATGTCATGATGAGCAAGTTTAGCAAGGAAATCGCACCGTTCTTGGAGCTGGCGCAGCGTTTAACAGCGGACCGGAAGTTTGACCTC
ATCACTTGCTTTAGCGTGACGATGTGGATACATTTGAATAATGGAGATGACGGGCTATGGAAGTTCCTCGAGACGGTTAGCGATATGACCGAGCACCTCA
TCATCGAGCCGCAGACGTGGAAATGCTATCGGTAGGTGGCACTTTCTGTGTTTCGTTGTGACTTAAAGTTTGTGATGCTTTTCTTGATCCTAATCCTAAT
GTATCGTTGTCTTTGAATCATTTTCAACAACAGCAACGCGCAGAAGCGGTTGACCCGCATGCGGGTTGAGGTACCCCAGTCCTTCCGCAAGATCAAGGTG
CGTACGGACGTCGTGGAGAAGATTGATGCGTTTCTGCTGGCTGCGGGCCGATTCCGCTACAAGGCACAATTGGGCAAGACCAACTGGTCGAGGAACGTCG
TGCTCTACAGCCGCAAGACTGTGCCCGGGATCACTTATACCTCTTGAAAAATCTCACAGGATCTACTACGTGGAAGCCCTCGTAACCAGATCAATATAGC
GTGTATCTATCCCACCTACCTTACATCTGTGAGCATGCGTTGAGCCGACCGATTTCATCACTGGTGGTCACTCTCGACGACATAATTCGCATGATGGAAT
ACCGTTCTTGCAGGGTATGCTCCACAATTGTTACTGGCATTTCTGAATCCGGCGCGATGGAGAAACTGCAGGACTACCTTGATGTTGCATACGCCCTGGT
AACACTGCAGGCCGTGGTGCTTGTGCCGACGCTCGCCCGTATCCGCCTCGTGTACACGTTTCTGTGGAACGTGTTCACCGTCATCGCCACCAAGATGGAG
TCCCCAACGGCACTGGGGCTCGCGATGGTCATGGGGCTGTCGGTGATGTTATCATGGTACGCGCTGAGATTCTTCGATCGATCCGTGTTTGACAGCATGC
TGCTGGGCTGGTTCGGCTTCATAAGCAAGTACCACGTCTTCCGGGACCTCGCGAATGCCGGCAACTTCCTGTTACACTTCATGTGCCCAGTAGTCTTCAC
CGCCAAGTACATGGCTTACGTCGAGGTGTGGATGGCGCTGACGATACTAGGGTGCGTGAAATGATGGCGAAGCTGAGCCGCTGCAATTGACACTAACCAA
GTGTCTGTGCTTCGTGCGATTCGTGAAGCATCTCGGTGTTGTGGGTGTACTTTGTCGCGGACGGCGCGCTGATCGCCAACGATATCTACCACTTCTCACC
GCCACGTTCACTGCAATTTGGGCTGTGGCAAGTGATCTTGAGCAACCTGACAGTCCCGCTCAGCTGCGTGCTAGTCCAGTGGAGCGGCGTGTCGGACTTA
CTTACCAGTACTGCCCAGGAAGCGGCGCGGTTGTTCTTCAGTAAATAATGCTGAATCAGATATCTACCTCTTGAAATTCAAGTGAATCGCTCGTTACCTT
TACAATGGAGAGGACGCTTACAAAACTCCACAAAAGTGGAAGGTTAGTCCACAGCACGAAGCAAAACCCTTGCTAATCGAATAGAAATGCGTTGGAGCAA
CTACAGCAGCAACGTTAAAAGTAACCTTATTCAGGTTGAAGCTTAGATGCATTTGCGAATCACTTTCTCACTCGTGCTTTAAGTCTAAATAGAGGAAGCC
CAGGTGATGTTCCGGATGCCGTGGTCTCTGTCGACGCTGTCTTTGTTGATCCGCAAGTGGCCAACGCATAGCATGGCTTCCACCGGAGGTTTATCGCTTC
CTTTTGTTCTCCTGTGCTTGAATTAGTTGACGGGGCTCATCACCTTTTTGAAACCGTTGAAACCGCCACGATGTGTAAAAGTTGAAAAGTCGCAATATCA
CATAAAACGTGCACACTTGAGATAGAGTTAACAATTCTCTGCAATTTCCTACAGCATAAATTAGCACAGAATTATAGAAAGTGAGAAGCTCTAATGCTGT
TTTGGAAGAGTTCATTAATGTAATGAGATGATAAAACTAAACGTGATATTAATAAATGTAAGTTAGGAAAGGTAAAGCTAGCGTCCTGAACTCGAATCAT
CATGGCGGAACAAACGTCTCGGTAGGTCTTAGCGCAAGCAACTGTTCCGCGGTCTCAGCACTCGTCTCCAAAAAAAGCAGGCCAACGTCATTTTTGATCT
TATCATTCCCCTGAGTAGCATCATGGACGCCGCCGAGCTCTTCAGCGTGGCGCATGACACGCTGACCCGCACGGTGCTGCGAGTGCGCGATGGCGAGCAG
CGTGCGACTACCGGAACGCTACTGAGTCCAGACGCTGCCCAGGCCGTGGTGCTGCTGTTCGCCATGACGCTGCTGCCTGTTCTGGTCCGTGTGCGGATTC
TCTACACATTCTGCTGGGCGGCTTTCACCGTAGTGGCACACGTTACCGAGTCGGAGGCGGCGCTAGGCATGGCCACGTCACTGGGTCTCACCATCATGAT
GGGATGGTACTCGCTGCGCACGCTCGACCGCGCCACGTTCATGGGCATCCTGCAGGGCTGGTTCGGCCTCCTGAGCAAGTACTGGCCATTCCGACTGCTC
GCCAACTCCGTCGACCTCCTGCTACACATGGGTGTACCTCTCACGCTCGCATTCTGCTACCTGCCGCTCGTGCGGGTCTGGATGACACTTCCAATCTTAA
TGTACGTCGGGTTGGCTTCGTGATTGCGAGCCTCGACCTTTCTGACTCTTTTACATTGTGTATGTCGAGCAGCTTCTCTCAACTCTGGATCAAGCTGGTC
GCTGGCGGAGACCTCTGTCTTTCTGGCAACGATGTATACCACATCTACCCTCCTCGCCCCAAGGCCTTCTGGCTGGCGGTTCGGAAGATCGAGCTGATCT
ACAACTTTACCGTTCCGACGTTTTGCGTGCTCGCTTACCGAGCAGGTTTTCACGAGTTCGTCGTCAATTGCTTGCTTAAACCGAGCTTGTAGGTTGGAGC
ACGCAGCCTTCGCCATGCCAGCAGCTAGACAGCATAAAGAAATGATCCATGCAATCTCACCTTAAACTCTGTAATAAAGATCCCCGCGGAGTTCATAGGT
GCTGTCTGGCAAAATCCCTGTTCCTTCACACCCGAGGACATCAAGGCAACCAACTCGCGCAATCTTTTGAAGATGGCCGCAGAAACGATAGCTTTCGTGA
TATCCTTAGTGTTAATACTAAAACTAAAGAGTCTTAGGATATCAACAGATCGCTTCAGTTTCCATTTCGCAATCACTTTGCAAAGAGCTCACGATGGACA
CGCTGCTGGGTTGGGGGACGCTGAGCCGCGCCAACCCCGATGCTGTACAGACACACGGCCAAGTTGACGCTGCACTGGCCATCGCGTTGCTCTTCAGTGT
AGTTGTGCTACCTCCACTCATTGGAATCCGCACCATGTACACCAATTGCTGGTTCGTATTCACCTTGATCGCGCATCTGTTGGCATCCGAGGCGGCGCTG
GGTATCGCCACGTCCATGGGCATCACTATCATGGTGGGTTGGTACTCTTTGCGCGTGTTTGACCGCTATGCCTTCACGGCCATCCTCAACGGCTGGCTCG
GAGTCTGGGCCAGCTCTCCATTACTCGGCTTCGCGGCGCGTGTCGGTGACATCATGCTACACCTACTTGTGCCAATGCTACTGGTCTCATGCTACCTCCC
TCTCGTCCGCGTGTGGATGAGCGTTCCAGCGTTAATGTAGGACAAGTTTGACGCTCTTGACTTAGGTGTGGAACTCTAACGCTGACAATTTCTGTTTTGG
CATTGTGTTTTGAGCAGATCATCGCGACTGTGGAGCCACTTTGTCGTTGGCGGCGGAGTTTTCCCCAAGGCTGACCACATCTATCGCTTCTCGCCGCCGC
GTTCGCAGCACTTTTGGAATGCAGCGTATAAGATGGAGCTCATGCTGAACCTACTTGTCCCGCTCTTCTGCGTGCTGGCACACCAGGTAGTAAATTGAAA
CGTACACGCCCCCAAGTTTCTACCCAGACTACTAGATACCATTGTCGTGTCTTAGTGCTGGGTGGACGTGTCTAAAGTCCTTTTCTAATATCATACTTGT
GCGCTTGATGTTGTTTGGTGGTCATGTTGGTGGCAGAGGTCGTTTTGGGTGTACGTCGCTACGGCGATCGCGGGAGCAATTCTGTTTTGTCTCCAGTTGA
TCCGCTCACTATCGCTGCCTAAATTACGGAGGAATGCTAAGACAATCATGTGCCGTTTGCTGTCCAGCGGTGGTATTCGACCCAATCTGGTAGGTGTTCA
CTCAGGCATCGAAAAACATTTACACATGAGAGCTTGTCACTTACTCTGGTACAGGACTTTATTGTCAGAGACGACTCGTTCTGGCTGGATTGGATGAGTG
AAGGGCTTGTAGCAATTGGTGAGTCCTACGTTGGCTGTCTATGGGCGACCAACTCGTCTCGCACTCTGGACGACGTTGTCGCTAGCCTACTTACGATCCC
GATGGAGGGCAGACAAGAGATGTACCGATCCTGGAGCGCTCGTTTTGTGGCACTGGCTGCGAGGTTGTTCAACTATCCCCCGTCATCTATGGGGCTCGTT
GTTGGCGCTGTATCGGAACAGTTTGATCTCTGTCCCGAATTCCGACTGGCCTACATGGACCGATATTTCCATCAGGGCTTTGGTATTTGGACAGCCGGGA
CAACAACCATCGACGATGCACAGACCAACAAGCTTGCCAATTTGGATCAGCAGCTGGACATTCGGGTGAGTACACGAAGAAATGGCTTTTTACCGTCTAA
GCTCACTTTCTAATTCTTGTGCGTTAGACTGGCCATACCATCTTGGACATTAGCATCGGGTCATGGGGAGGGGTCGGCTGCTATCTAGCTCAGCAGCATC
CTGATGCCACCATTGTCTCCGTGCTGTCGTCGGTTCAAGAATTCGCACGCGCCAAGAAATTCGCCCGCGAACTTGACGTCTTCGATCAAATGGAGTTTGT
GCTCGCTGAGACGCCTGAAAAGCTGCTGACACTTTTGAGCGGCTTCCGCGCATCGAAGTTTGACCGCATCACGCTGTGTGGCGTAATGGAGACTGTACCG
GATGTGCAACGCACTCGATTCCTGCGAACGCTGAAGCGTATCCAGACCGCGAACGGCACGACGCTACTGGAATTCAGCGCCTGCACGGCCGCGCACATGG
CGACCCATGCCTGGACCAACAAGTACGTGCACAGCTCATATCCTTGCTATGCTATTACTCTGCCGCTCATGCGTCGACTAGCCGGTGAGACGGGCTTCAC
GCTTCGAGACACGCTCGGGTACTCGGATCACTACGAACGCACATTTCTCGAGTGGAACCGTCGATTCCAAGCGCAATGGGGCCATGACGCAACATCCAAT
GCAGTTGGCCAAGCCACGACAATGACCCAAACAACTCAGGTGCAATACTTGCCGTCGCTTCCCGAGTCCTTTAAACGCACGTGGGAGTTCTACCTGTTGC
ACTCTGCTGCTTGCTACCGATCCGGTGCACTTCAAGTGTTCCAGATTAGAATGAGTTAATCCAAATTCAAAATTAGGCTTGAACAAATCAATCTCGACCA
CCAAAGCTTTTAGAAGCTCTAAATTAGAACGCAGTATCAATTATGACGACCGCGTCAGCCGACGACACCGAGTGGGAAAAGCACGTGGACGAAGCCTCCA
GTTCCGCGTACTACTACAACACTCGCACAGGCGAGTCATCATGGGAGATCCCTGCTGGCTTTAGATCTCCAGAGGGACAAGATATGAGCAAGGACAAGAC
CCCAAAGTGGCGCGAGTTCGTGGACGATGAATCGGGAGCCACTTACTATTACGACGAAGTAAGCAGCACCAGTCGATGGGAGAAACCAGAAGACTTCGTA
CCTGGGCAAGACAGTGAGAAGCAGGACAAAGCAACGGAACCCGAAGAGCAGCAAGACGAGGCAGAGACACCAGAGCAGGAACCTCAAGGCGAAACAGAGG
AGGCGTCCACAGGTGACAATAAGAAGGAGACAAAGGAGGTTTCAGTGGACATAACTGCTGCTGTTAAGGCTGCGCAGTGGGTGAAGTACGTGGACGCTGC
CAGCAACAATCCGTACTATTACAATGCCAGCACGGGGAAGACGCAGTGGGAGGAGCCTGATGAATTCGATGAGTCAGCAGTTCCCATGGCTCCCCAGGTC
TCGGCTGAGTATCAGGCTCATCTTAACCGGATGCGCACGGAGCGACTAGCACGAGTGACGCAACAAGTGCTGGACCCATCGGGCAACCTCAGCAAGCTCA
ATGCCATTTTGAATGGTATCGATAGTAGCGCTCCTTCTCCAGCAACAGTGGATAGGGAGGGTGATGATGATCCACGAATACCTAAAGCGGAGTGGCAACA
GCATGTCGACGCGCAAACACAGCGATATTACTACCACAATGTGGTCACAGGAGTGACGCAGTGGACCAAGCCAGACGCGCCTATTGTGTCGGGGGTACGT
TTGGTCATTTAGTTTTTTCATATACGAGAGAGTGGTGTGCTTATATCCTGGAAACTGTTTGTGCTGTGGCCATTATGGCGTGTAGTTGGCGAATTGGATT
CCTCCTGAAGTTCCTGTGTCCAGCTCGACTGGCCCTGGTCAGAA