Description :
From Genome Similarity Track
Location :
Scaffold_7:27606- 28647
Transcript NameFunction/comments
Phyta_totarag498hypothetical protein

Sequence
1041 bases(100 bases per row)
CAAGGGGGTGTTGTAAGGGCACTAGAGCTTGCAGCACACGTAGCGCCGACTGCTGTACAACCGCTGACCTACTATTCAGGAAAGTCCCCCATATTAATCT
CATCCATTTCAAAAATTGAGAACGGAAGTGGACAAATCCTTCGGACGAAGAACTCAGCAAAATTAATAGAGCGTGTAGCTCCACGATCTTGGAGTGGTCG
TTGACAGCTCCATCGGACGGaggcttcttctcgtcgaatACAATCCGAACGTGAATGGGAGACAACGAGCGATTGTGGAAACGGAAGTGGCTCAACCAGC
CATCTAAGCAATGTAAAGCTCCCGTCTTCAGTTCCGATGTAGAGGGGGCAGTGTTGGATGGAGTCATTCCTGGATCCCAACCAGTACCTTTCATGATTCC
AAGGGAGTGCGACAAGAAGTTCATACCCGAAGAGACTGCAGAGTTTGGCTGTGCTGTTGGCAATCGACCAAAGTGGAATGGCAGATCCACACTCCCAGCC
GCCCAAATAGGAATACTTTGTGCGGTAAGAGAGCGCTGGCAGTCGAGAACACCATTCAAATACAGACGAAGTTTCACTGCTTCCAacacgacagcgacgt
gaaCCCACTTGCCTCCAGCTACAATTTGTTTCGACATCACACGCTCCCACATACGGCCCTTTACAGTGAGTTCTCCAGCGTCCGCTTCTCGATTTAAATC
CATGAGAATCCCGACTTCTAGCTGCCAGTTGCCAATGCTTTCAGGCACTAAAACTAGATAGAGCGATATCTCGCTGGCTGCACCACGCATGAACACCAAC
TGACGGTCTTGTAGACCATGAGGCAAGTCAAAAAGGTCACCATCCGTTGTCCGTGAGCGTGGCATTGATGAATTGTTGATATACATCCAGGTAGTAACAC
TAAACTCGTTCGGTTTGAGCAAAGGAGACATCGGGGTGACAGTCTCAGATCCGGATGGGAAGATCATTTCACCGTAGCTGAAGGTGACCCCTCTACTCTG
GGAAGAAAATCGTTGGGGCTGCGTAATAACCTCAAAGCTCC