Description :
From Genome Similarity Track
Location :
scaffold_6:276031- 277900
Sequence
1869 bases(100 bases per row)
gcgctcgaccaccgagctttgagatggctagcgctacgcgctgttgcttggtcTNNNNNNNNNNttccagaagcgatgacgagcttatatcctcgtccgg
tcgtaccaTGAcgacttcggccaaatcgcctgccttcaaggcactgccgaaatcttcaaaggacatctcgtccagctcaagaagagcatctactgcaggc
atagcctcgagtcggacgtcgccatcttcctccccgtctTACCGTTGaagagggtgtataactgtgcaccgtcgtctacagTAGATACACCCTGGGCCag
agtcgacgcccggcgccttgcagccagcatacggcgtcgctgtcgcctctgtacagaggttctatgtctcggtgNNNNNNNNNNTAGCCCGACTGGGCAA
catggaattggtggactttgtgcaAGAGATGCGCTCTTTCTAGCCGAAATGATAGCAGATctccttccggaggcggtcacagtgaccattTTCATGAAAG
TCCTCCGCACTGGTtaaaatgaaagtcttccgtgtgcatccgtcttcgtttgaagaggtggtgaatgtggcattgaatgccgaattcaatttcaagtcgg
cacgacNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATCAGCGTGAACGGGCtg
tttcaccctcgcgtcccactgaagccgccatcccaaggctcagggcttggtgagggaggaattgccgaacggctagctgatgtcagccacctcaccatcc
gcaaagaagtcgatgacttcttgtctaccagacggAGTGTCGtatgacacgttcgcgatgcgatggctgaaagccaagatctgcagaaagaatatgcaga
taaaaaaggaagaggtaaagcggaaagctttaaggtcggagacctggttttattaagctctaaaaacctgcctacacatgcagcctctgctatcgtTTGG
GCGAAATTTCGTCCACGATTAATTGAACCTTTTAAggatgtggccaagcggggcctagcgtatacgccaaaccttcccaaacggatgcgcacgcacccgg
tgttttacgtggtttgctcaagccgaattgggatccggcgcatgttaacgcggaagcgttggcgccagagcggatcccacgggccctcggccacccagaa
actgaaccaNNNNNNNNNNTGGTGATGAgatgcgtagcgctgctacgggctctcggaagcaagttgtctggagactcggacaagaaattgttacCAAGAC
TAAGTGTAAGATTGCATCGATACTCGTTGAGTAActgcttgctatattatagcacctatgtaacggatacaccacgaattgtgattcctcatgatgagga
tttgaaatatcgcgtcttctatgaggctcacgacactccactcagtggtcatctcggtcgtgagaacaCGTACAACCCTGTGAGTCACCGCTATTGGTgg
ccaagttgtacaaatggacaagtcatctatgtgcgcacgtgtgagacgtgtgaacgggtgaaaccctctccaaatgcggctgagccgctggccagctttc
cGGTACCCGCTGGGTGCTAGCAGTCCAGGATTATTGGACTTTGCGTAtagcctgccgaaagattcggcgggcaacacgggtgtcgtggtattcgtcgacc
agNNNNNNNNNNAAGTCGCCCCagctctcgcagagaatggctagatggctatccttcttctcgaaatataacttcaaggtgatgtataagccgggaaagc
agaatgctttggctgatgcgttgtcacgcagaccagactatNNNNNNNNNNTTTTAGCGCAGTCAGACC