Description :
From Genome Similarity Track
Location :
Scaffold_27:276004- 278215
Sequence
2211 bases(100 bases per row)
TTTGTCGCGCTGGTGGAGACACAAACTGGAAAGCGCGTGAGGTTTCCTCGAAGCGACAATGGTGGCGAGCACACCTTCGGTACGATGACCAAGTTCTATG
GGGACCATGGTATTGTGCAGCAATTTACACCACCTTACACTCCTCAACTTAACGGTGTCGCCGAGCGGATGAATCGGACGTTGGTGGAAAGCGCGCGCTG
CATGATGGAACATGCTGCGTTATCCAAGTCGTATTGGGGTAAGGCAGTCATGGCCGCGAACTTCCTACGCTTCGCTGCCCAACTCGATCTACGGACCATG
ACGAGACACCATACCACGTATGGACGGGCAAGAAACCTCTTCTTGCGAACATGAAGGTTTTGGATGTCATGCATACGTTCATATGCCCAAGCCAAAGAGG
TCCAATATTGACGCAAGATCGGTTCATTGCCGGTTTATCGGTTACTCAGATCATGAGAAAGCGTATCGTTTTAAGGAGATCAGGAGCAGGCGTGTGCTGG
TAAGTCGCGACACGCAGTTCATGGAGAACATCTTAGATAGTGGGAGACGTGACTACGTTCCAGATGAAGTAGTCCTCGAAGATGAACAGCTGACTGAAGA
AGAATACTCCCATAGCAACAACACTGACACGGGATCAGAGGATACTACGCAGGATGGTAACAATGCAACCGGGGTCAAGAGGCACCAGCGCACACAGTCT
TCGAGGCATTAGCCAACCCTCCATAGGCGAAAAGACCAACTCGATACCTCACCATGGCCGAAATGTCTGCGGCAGAGCATGACATTCCCGACGTTGAGAC
TTCCTACATCGTGAATTCAGTGGGAGAAATGCTGAAAACTTTCAAGTCAGGAATGGAATCCAGCGATGCAGTCAGGTGGAAAGAGGCATGTAATTCTGAA
ATAACTTCCCTCCGCCAGAATGCGACGTGGGAGCTTGTGCCGCTGCCAAAGGGGCGCAAGGCAATCAGTAATCGATGGATTTCTCGGGTAAAGGAAACGA
AGGATGGGACAATCGAGCGGTTCAAAGCGCGTTTGGTGGCGAAAGGTTTTCTGCAGAAACATGGCATCGACTATGAAGAGACTTTCGCTCTGGTGGCCAA
GTTTACGTCAATCAGGATCTTAATCAGCGTGGCGGCAAAGTACAATCTAATGCTTTAGTAGATGGATGTCAAGACATCCTTCCTAAACAGAAGGCTTGAT
GAAGACATCTTCATGACACAGCCGGATGGATATGTTGATGAAGATCACCCAGATCTCGTTTCCCATCGCAAGCGCTCTCTGTATGATCTGAAGCAGTCAC
CACGGATGTGGAACCAGACCATCGACAAGTTTATGCTGGACTTGAAGTTTCAAAAATGTGAGACCGACCACTGCATTTACCTCGAGCGAGATGATTAGGA
CATGGTTTTCGTGGCGCTGTACGCTGAAGATTTAGTCATCGCAAGTAACAAGTTCGAGCTGATACAATCAACTAACCAGGCGCTAATTGAACGCTTCGAC
ATGACAGACCTGGGCGACCTTAAGTACTTCCTCGGGATGGAAATTGGTCAAGACCTCTCAGCCGGCGCGATTTCAATCCGTCAGTCCAAATTTACAAAGG
ACATTCTCGAGAAGTTTGGCATGGCAAACTACAATCCTGTCAAGACTCCACAAGAACCTGGACTCAAGTTGACAAGGTAAATGTGTGTAGATGGGTGCAA
GCATGCGGAAACAACGGCGAATGTGCCATACCGCAATGCCATTGGCTGCTTAATATATATCATAGTGGTGACCCGCCCGAATATCGCAGTTGCAGTGGGA
GTGCTCAGTTAGTTCGTGTCAGAACCTTGTCCAACCCATTGGCAAGCGCTTAAGCGGGTGTTCCGTTATATTCAAGTCACAAGGACGTATGGAATTGAGT
TACAAGCAACCAGTGATGACAAATTGCAAGGCTACTCAAATGCGGACTTGGCTGGAGACGTGGAGGATAGACGAATGACAAGCGAATACGCCTTTTTGAT
GAAAACCGGATGCATTAGCTGGAGAAGTAAGAAACAGAGCACCGTGGCTCTATCGTCTACAGAAGCTGAGTACATGGCTTTGACTAATCCTGCACACGAA
GCGATTTGGCTTAAAGCATTCTTACATGAACTCAGCAAGATCAATAGCAACGAAGCAGTCAAGATCTACGAAGACAATCAAGGTTCCATCGCTTTGGCCA
AGAACCCCGAG