Description :
From Genome Similarity Track
Location :
Scaffold_1506:2760- 6349
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1506-snap-gene-0.3ATP-binding Cassette (ABC) Superfamily
Pytul_var.sporangiiferummaker-pug3_contig_1506-snap-gene-0.4AN110

Sequence
3589 bases(100 bases per row)
TAAACACACTGCCTGGGGTCGTGCGGTTGTCAGCGACGCGCTTGCCACCGTACCACAATCCGGCCGCGTACATGAACCACATGCTGCAAAAGAACACGCC
GATCACGATGGCCATCAGCTTGGCGAGCGCGATGTTTTCCTGCTCGGCCTGCTTCGCCTTGGCGTTGTACTTGGTGATCGCGCGCATTTCGCCGTTGTTT
GAAACGACCGTGCGCATCGAACCAAGTGTTTCCTCTGCGACGGCGCCGGCTTCTGCATACACTTTATNNNNNNNNNNNNNNNNNNNNNNNNNGAGCGTCT
TGAGCATCCACGCAAGCGAGAAAGCGATGCACGGCATCACACAGGCCATGACGAGCGAGATGTCCCAGCCCTTGACAAAACCAATGATGTACCCTGCGAT
AAATTGGGCCGTGAACCGCAATGAATCCCCCAACTTCTGACCTATACCCTCACGGATCTTGACGGTATCCCCTGTGAGCCGACTCGCGAGTTGCAACGCG
TCGTGGCCGTCGTACCACGAAATGTCGAGATGCAGCATGTGCGCAAAGCCCTGTTGCCGCAGCGCTTTCATCTGCCGCTCAGCCGTTGTGAAAAACATCA
CATAGGACACGTAATCCGTGATAAACAAGATGATCGCGACGCCAAAGTACAGCAGCGCAGCGTGGTTCACCGCAGCTTCGTCGTACGGCTGGAAACTCGA
AATCGCGTCGCCAAAGATCAGCGCCATGCACGGGAACAGCGCACCATTGATCACCGTCATGATCAATCCGAGCATGAGAAGCACGATGTCTCCACGCGTT
GCGTACCGGTACAAATCCCGGAACTGGAACACCGCGGCTGGATCTTGCTCTTCACTTTTTGCTTCTTCTTCTGGGCGCTGGGACGACTCTTTCGCAGCGA
CTTTGCTGTTTTGGGGGCTCTTGATCTTCGTTGACGGCGTTGGTCTGGCCGCAAGTGTCGTTTCCGACGTCGATCCCGGTATCGCTACATCGCCGTTAAT
ATCGTGTAGCTCGGGCTTTTCATCATTGCGCGGAGTCGCAACTTGCTGGTAATACTCGACCTCGTCGGTATGGTGCTCGTCGGACGGAATGATACTCGCC
ATCAACTCCTAGACGTCTTCAATTGTACCAGGAAAGCAACGATCGTGACGCTCGCTTCCTCCTGCGCTTCTCACGTACGAACCACGAGTGTGCATGCGAG
TGAGCTTTGCGGCTCGCTACTCGTTCTCAATCTGGGGGAAAGCCAACCGGCTGAGCACCGAACGGCAGAAGAACCAAAATATGTGTCGTTTCGCAACCCT
GCAATAATCAAATACGCACACAACACACACACATCAGACTCAGAGAAAGAAAGCGCCGCATTGAAACGGATCAGTGGCGTAGAGTCGCTCTCTATACGAC
GTGGTGCAACGCAACTGAACCCACCTTCTGTTGAAGAAGCGCTTATTTCCATAGAAAAACTGGCCAAAGTTGTTGTCACTCCTCACCCTACATACACGTG
AGACGAGGGCGGAGAAGCTCAGAAACGGAAAGAAAGGATGTTCTCACCATGGTCTATTTTTTTCTTTGTGCGTTTGTGTTGCTCTGCCGTTGCTTCTATG
TATTGTACAGTAGGCACTTCCTGCGCGCACGAGTCCTGTCGTCATCGCCTGCTTCACCATGGCTACGAGATGTTGCACTTCTCCTGGCCGCCAGAAGACG
ATGACGCGCCGGACGCTGAAGCAGCCACGGTCGTAGCGTGCGCTGTCTCCACGTGATGAATCAGCGCCGCGACATCGGAAAACACTGCATGGCATTGCGG
GCACACTTCTCGCCCTTCTGATCCTGTGCTCGAAGGACTCGATGTGAGGTCAATAGGCCGAGATGCAGACGACGAAGCACTTTGACGTGAAGACGCTGCT
GCCCCGTTATCCGGATGCGCATTGTTGACATGAGCGATCAGCTGGGACACGTACGCAAACTTCTTTTGGCAAATCGGGCACTCCTCCGAGTTAGTGGTGA
TTAAATTCGCCGATGCAGCACTCGCCGAAGCGGCTGCGGTCTACAAAATCGAGGTACAAAAACAAGAGAGGGGAAAGCACATTCATGAGCATTATATATA
CTGCTGATACTGTCTTTATACAACAGGCACGTACCTTCGCGTTCTGGACAAGCGAATTGACAGCAGATTTGGTGCCTTTGACCACACTTGTCGCCGCTTG
TCTGGCATTCTGCTGCAATTTCGCTGTCGATGGTGCTGCGGACGACGATCTTCGATTCACAGCCGTATTCGAGTTGTTTTGCGTTCTCGTAAACCCAGCG
AGCGACCAAGATTGCTGCTGCTGTTGACGCAACTGGATGCGCACGTTCTCACAATCATGATCACTCTCAAACCGGTGCTTCATGCACACATTCTGTCGAC
ACTTCGTACAGCTAAACTGGTTCGACGCCGTGAGGATCTCTCGACACTGCGCGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGGTTTCTTCTTCTTCTTCGGCGCTCCGGCCGCATTCGTACCGCCGAGTGTCTNNNNNNNNNNGTGGTCCTCCCACACGATATTGACGTCCTGCTCGA
GCGTCCAGTGCAGTGACGCGCTGCAGAGCGGACATGTGATGACGCGGCGGTCCTTGCTGCCGGCCAGCGGGCACTCGTGCGCGTCGTACGTGCGGTGGTG
TAGGCAAAAGACGCTCTTGCAGCAGTCGCACGTGAACGGCAAAAAGTCCACCTGGTTGCACGCGCCGACGGAGCAGTGCGCGCCAATGTCCATTTTGGTC
GATCGATTGATTCGTTCTTTTAGCTTTTTGGGAGTGTGGGGTTGCCGTGAAACAGGGAAATGGCTTGGTGAAGAAAAAGGTCCAAGCGTTGGGAGGGAGA
GTGCCTGGATATAATGGCGATTTGATTTGATGCGAAAAACGATGCCGAAGTTTCGAGAAAAAAGAATAGCATTTCGTAATCGTGATTTGACATAAACCTT
CTTATAACGGATTTTACCTGTGTATTGTAGTTAACAGGTAGTTCAAGCCGGAAGGTGGTACAGTACCGTTGAAACGGTATGGAATGAATGAATGTTATGC
GTCAGCAGAAGTCATCTGTGACAACTGTGTTCGTAATCTGGATTAAGTTCGTTTTTGGGCTGACTCAGATTTCAGAGAAAAAAGCTTCTGATCCCACAAT
CGCACTTCATCAACATTGCACTGTAATATCAATTATCAGCTGCTTAATTCCCGTCAACGACAGATGTTTTGCTCCTTCCCCATCCTTTTGCACCAAAACC
TTTGTATCTGCATTCACTTAAAACTTGCAATTTTAGAATTATATTGAATTACTCAGAGCACACACCATTGTGTTCGTGTATTCCCTCTTTCCATTCTGAT
TGTGCAACCAAGTCAGCCAATATGCAACGACACAGGTCCCTCCTCTTGACGGCACATCGGCGCGGCGTGCACCACACACCGACCCACAATGCAAAATTCA
TGGTGCACCTGAAGCAGTAGCAGCATTGCAGGTGACGTCGTAGCGCGAGACAAAACAGCAGACGAGAAGCAGCGCTTTCCCCCATATCC