Description :
From Genome Similarity Track
Location :
Scaffold_258:276- 5728
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_258-snap-gene-0.8Secretory protein OPEL
Pytar_ATCC12531fgenesh_masked-par_contig_258-abinit-gene-0.32Deoxycytidylate deaminase
Pytar_ATCC12531maker-par_contig_258-fgenesh-gene-0.4Myb domain-containing protein
Pytar_ATCC12531maker-par_contig_258-snap-gene-0.13Membrane protein

Sequence
5452 bases(100 bases per row)
CTCCGCCATAACCCAAAGTGCCTCCTCCCGCACAACGGACCTCCTACGCACACCCTCGCACCTTCCTCCCCTCCCCTCCCCTCCCTCCTCTCCTCCACCA
TGAAGGTCTTCAACGTCATCCGCACGACGCTCCTCGTGGCCGCGGTGCTTGGTGCGTGCGTCTCTACCACCGACGCCAAGAAGCACAAGCTCTGTGACGC
CGACGGCCACGCGCCCGGCAAGCCCGGAGTGGCGCCACCCAACGTGGGCGGCGCGGCTGGTACTCCCAACCAGTCTGTGCCAGGCAACGGTACTGCTCCT
GGTGCCCCTGGTGCTCCGGGTGCCCCGGGTGCGCCGGGTGCTCCTAAGGCTCCGGGTGCCCCGGTTGCTCCGGGTGCTCCGGGTGCTCCGGGTGCCCCTG
GCGCTCCGGGTGCTCCTGGTGCCCCGGGTGCTCCTGCTACCCCTGTCGCCCCGTCGGGTGGTGTCGTCACGAGCGCTGGCAACACCAAGGGCTCGTTCTC
GTACAAGGGCGGCAACGCCGGCGGCCCCGGCACGTACCAAATGGTCACCGACTTTGCCTCGTGCAGCAAGAAGCCGCAGTCCAAGTCGTCGCCCATCTCG
CCGCTCGACGACGATCTCACGTTCGTGTTCCGCGGCCCGATGACGATCCACAACATTGCCATCTTCGACGGCATGAGCGGCAACGGCACGTGGACCAAGG
TGTCGTCGTTCACCAAGGGCGGCGCCACGCAGAACATGGTCTTCTTCAACAACCGCAACATTGACTACGGCGGAAAGTCGAGCCCGCAGGGCTTCGCGAC
CCCGGACGGCCGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCGGGCGAGCTCGGTGCGGCGACGAGCCCG
AACGGCTTCTCGATCTACGCCGATGAAAAGACGGGCGCTGAAGTCAACATTTTCCAGGACAGGAAGTGCGGTGACAAGGGCGTTGACTGCATCGGCTACT
ACGACAAGGACGGCACGGCCTACCAGGGCTGGGGCGGCGCCAAGAAGATCTTCATTACCAAGGTGCAGATGCCGCGCGGCGGTGCGCCCGACATGCCCGC
GATCTGGGGCCTCAACGGCCAGATCGTGCGCTCGAGCCAGTACGGNNNNNNNNNNNNNNNNCTCAAACCAGTATGGCTGCAACTGCCGTGGCATGGGTGG
TGTGGGCGGCTGTGGCGAACTCGACATTGCCGAGGTCATTGAGAAGGACTTGAGCGTGGTCGCGACTCACTACTACAAGTACGAGAGCAGCACGGGCCAC
GACTCGTGGGGCAAGCGCCCGTGTGAGGCCCCGACGACCTACATCACGATCATTGACGAGACCTTCGGTGTCAAGGTGGTCGAGGTCGACAACTTTGACT
TCACGGCCGGCATGATCTCGACGGACGTTGTCGCCAAGTGGCTCAGCGCCTAAGGCGTCAGCCTCATTCTTGTGATGGGGACGGTCGGGTCCCCCCGCAA
CGGTTTTGGGTTCGACGGAATCGCCTGCATATACCATATAAAGTTGTTGTAAAACGAAACTTTTGCTGATTTTGCACTTGATGCGATGGAGATCAGTGTC
TACAGTACTACTAATCAGGCGATTGCGGAGAAGTCGATGACGACCGTGGGCTTGCTCACGTGGTGCTGGCGGTACTGGACGCCGGCCATGTCGAGCATGC
GACGCGATGCGACCATCTTCCAGCTAATTAATCCATTCATCCATCCATCCATCAACTATTAGGCGCATCAATCACTTGTCCTTCAACAAATGTTCACTTA
CTCGTCGTGATATTTGTCCGAGAGAAAGACAATGTGGGTGATGCCGCTCTGGATGATGAGTTTGGCACACTCGTTGCACGGGAACAGCGCGATGTAGATC
TGCACCAGTTCCAGTCAGTTTTGATGGCAAACTATGCCCAGTGACATGGGGACGATCGCTACTTACCGTGCAGCCCTTGAGATCGCTCGCGTTCTTGTTG
AGGATGGCGTTCATCTCGGCGTGGCATACAAACTACCATCGCACACGAGTCAGCCACTCATCACTAGAGAACCTGCAGTCCAGCTCATGGCAGGAACTTA
CGGGGTACTTGGTCTCGAGCGGGTCGTTCTTGCTTTCACGCGCCCACGGCAGTGTGTCGTCGCTGCAGCCATTTGGGAAGCCATTGTAGCCAATGCCCAC
AATCTTCCTCTCGTTATTGACGATGCACGCGCCAACCTGCGTTGACGGGTCTGCCATGTACAGCAAAGCATCCATTAGCAACAGCTCCTTCATACTGCCA
TTGAGAAATCCTACCTTTGGAGCGCATGGCACTGAGGAACGCAACGCTCATAAAGTAGTCGTCCCATGAGATGTAGTCTTCGCGCTTCTTCACGACCGAT
GTTGGCGTGTCGCCGGTCGCTTTAGGCGTTGGTGCTGCTGTCGCCGCCGACGACGTCGATGAGGACGTCGATGCCGCCGAGCTCGCTCGAGACCGTCTAG
TGGAGGGCACCTTGGCCGGCGGCTCGACCACGTCCGCTTCCGCTGCAGCCTCGCTAGTGGCCGCTGCCACATTACTGGCCTTGCGCTTCTTCCGGCTGCC
GGAAGTGGGTGGCGTCGCCACTACCGGTGGCGGTGTCGTCGAAGCGTTAGCGTTCGACTTGGCGTTGGGTGTGGAAGGAGTCGGGGACGCTGCGGCCTTG
CTCTTGGTACTGGCCTTGGTGCGTGTCGCGGCTGCTGCCCGCTCGGACTTAGGCGAAGCGGGCGGCGTGGCCTGCACCTCGTCGGCGTGCTCGAGCACCC
ACGTCGGGTGCTTGAACAGGACGTGCTGCTTGAGGTTGGTGTAGCCGTGCTTGAGGCTCTGGATGCGGATCTTGCCGCAGCGGCAGCGAAAGTGCGGCAG
CTCCGAGTCCGTGTCGGCCGGAGGGTCCACCTGCGTGTAAAAGACCTCTTTGATCTTGCGGCCAGAGATCTTGAGGTCGCCCCAGGGTGCCGACATTGCG
AGCGCGAGTTGCGACGCCGCCATTTCAGATCGAAAAGACCCGCCGAATTTATTGGGGCGAAGGGGAAGGAAACCATCCGAGATGCGCAGCAATAATTGTG
ATTTTATTTTGACCAATCATAGGTACGTAATACATATTTAAACCAATCAAACACCCGGATTGTCTGGTGCTGTTGACGATATCGGGCTGTATGGGGAGTT
CTGTATGATCGATGCATGCTTGTGGTAGTCTACGATCAATTCAAGTTTTGTGGTGGAGGCATCTAGAAAGACATGTTCTTGTGGGCGTGGACGTCGTCGG
GGTTAAAGATGAGCGCTTGCTTGAGCCCGAGCAGCGATATGATGACCTTGAACTTGGCCCGGATGCCCAGCAGCTTGTGTAGGATGTCTTCGTCCACAAT
ATTCTATCAGAGTCGCAGCCAAAGCATTGTAGCAAGCCCGTCAGGAAACTGCAGCTGGTAGGACCTGACTTTCCCGTCTTACCTTAAGCTCGAACGCCTC
GACGAGCTGGCCAAATGACACAATGGACTTCGCAGCACGTTCACTGAACAGTCATAGACGAAGTCAGCATCGCCATCCACGGCCGCCAGCCCCCGCTAAA
GTATTCATTCTGATATAACCCCCTCACCTGATCTTCTGTCGGTACTCTTCGTGCTCTACCAGGAACTTCCACGTAGCGTAGCATCCGTGGTAAAAGCCGA
TCTCCGCGCCGATCTCAGTGCCTTTGATCACCCTGCGACGGCCAAATCCGAGCCAGTCAGATCGGAGGAGAACCGCCACGCTCGCCAATGATACGAAGTC
ACCCCAGCTCCCGTCCTTCTTCAACGCCCAGCAGCCGCCCGTGCTCGAGTCCGAGCTCCTCGCCCTCCGCGATGAGCTGCTCCTCCCACCCAGAGATCTC
GTCGAACGCGTCCGTGATGTCCATCGCGAAATTCGGAGCTCTTCGAATTTGGCTGACTCCGCCATTCAAGAAGGAGACCATCACTCTGTCTATTTCAGTT
ACGAACCCACTGTTGGATCTCCTCTACGGTAGGTACCACATGGCTACAAAACCTCCAACCGGCTCAGACCAAGCCGGGCGCCGCGCCGTAATCCGTCGGC
GTGGCCACAGGCGAGGCGGCAATGCTAGCGCTTGCAATGAGCGCCGTGAATTCGTTGATCTCAGGTAGCGAGTCGTGTGCAGCGAGCGCCGGTTGATCCT
CCGAGCGGACCTGGTGGAACGAGAACGACTCCTTGATCCTCTCGCGCTTGCCACTGCCGGATGCGTGCGAGTGCGAGTGGGACGCTGAGCCAATGTGGGT
CGAGTGGTCCCACATCGCGCTCGCGTGGCCGCGCTCCGTGTACATTTGGGGTAGCGGTTTGCCGCCCGAGACAAAGTAGTACTGGCTGCGCACGAGCACA
GTCAGCTCCTCTTCGATCTGCAGCAGTCGCGCCTCGAGGTCAATGTCGTTGGCGTCGAGCCCAAACGGACACTCGATCTCCATCGCGACCTGGTCGGCAG
TAAAGAGGAACGTGCCCCACACGAAGACCCACAGTGGCGTGTACAGCTCTGAGCGCGGCACGATCACAAACGTGTAGAGCATCATGTAGGCCGTGATGAG
AAACTGGAGGTACTGCATGTAGTTGAACGGAATCGGCACGTTGGCAATGTTGAACACGGTCGTGTAGAGCGTCGGGAGCTGAGCGATCTTGAGCTGCAGC
ATGTTGGCGTTTACGGGGCTCATGTGGCCGCGACGCGCCGCCACGTCAATGAGCCGCTTGAGCCAGAGCTCGACGATCGTCGCGCGCAGCTTGTGCGGCG
TGCGCTGCACAACGGCGTGGAACGACTCCTTGTTCGCAATCTTCTTGGGGCGCTCCGAGCCACACGCGTAGAGCTCGTCGTACTCGCTGTCGGTGAGCAC
CGCGGCGTCCTTCATCTTGTCAATGCCATCGCGGCCGCGGCAGTCGTGGAACACGATCGCAATGTAGAGGAAGACGAGGCGCCGTAGCTCCGTGAAGAAC
GTGCACTTCTCGAGCGTGTCGCGCGAGATGCCCTGGCTTGTGGCCTCGGCCTCGGCCTCCGCTTCGCAACTCGGATCGGCTCCTTGCTGCGGCGGCGCGG
GTGGGTGCGTGCTCNNNNNNNNNNNNNNNNNNNCGCAGCCCGACGAGACGATGCCGCGCGCGGCCTCGGACAGCGCGCTGGTCGCGACGACGCCGGCACG
CCACTGCTGAAACGCCGAGTTCATGCGGAACGAGATTGTGAGACCGAGGAACGTGTTGAAGACCGTGAGCGTGTCGACAAACGCCGTGCTCTCGCGCGTG
GCGACCACGAACGGGTAATAGCGGTTGGTCAAGGCCACGCCCAATGCGAAGAGCGCCATGACCAGCGCTCGGAAAGGTGCCGGGCCGTTGAGCGCCGAGC
CATGCCAGCGGAAGATGATGCCCCAGAAGTTGGCCGTGTCGTAGTAGATCAT