Description :
From Genome Similarity Track
Location :
scaffold_367:27595- 29541
Sequence
1946 bases(100 bases per row)
AAGTCCGCGTTCCAGCTGGATCAAGCCGCCGAGGAGGAGAAATGCCTCACTTTCGCGGATCTCATGATTGGTCCGGCGAAGAATTGGTATCGGCAGCTGA
GTCGAACGACCAAAACCAGGTGGGCAGATCTGCTGGACAGTTTCCAGACCCAATATTGCGGGTTAGGAATGTCAGTAGCATGGCAGTACTACCATGCACG
CAAACGATCTGAAGAAACCCCTCTCGATATTCTCTATCGTCTGAAAGTAGCAGCCTTGCGAGCTAAACCCAAGATCAAGGATGGAAATCCTAAGGTCCGT
CGGGAACACGTCGATCACTTCATCGCGACTTTGGGTGATCCCGAGCTGGCCGATCGCCTGCCCTTGCTTCGACTGACTGACGTCGACGATCTGGAGGAAA
TTCTCCGCGCTCGAGAACGAGCGAAGAGCCGACAGCGACGATCCGCGTTCGGATCGAAGTATCGACAAAAGACTCCATCGAGTACGCCCACGGCGCCCGC
CAGGGCTGTAGTCCGCGCGATCCAGGCCCAAGACCCGAATTCGGAGTCAGATGGGGTGTCCGGGTCAGATGAATCCGACTCGGAAGGAGATCTACGAAGG
ATCTACCTGGCCACGGCTGAAGACCAGTCGATCGGTACTCCCACCCACCAGATCAGGCGCGATCGCGCCCGAACACGCAAGATCGAGGCCAGATCTCCGA
TCGCCGGACCCACTCCGATCGTGATCACGAAGATCGAGGTCGATGCTCGCATTGTGGTTCCAGGAAGCACACGGGTCTCGATTGTTGGAAGCGATTGACC
TGCGAGAAGTGCGGGAAGAGGGGTCACCCGACGGATCGCTGCCTATATGTGTGCCGTGGGTGTTTAAAGGTCCACGAAGCCGGAGAATGCATCATGGAAG
AGTTCTACAACCAGATCCGCAAGTGGTATGATCCGACTCGACACGGAGGGATGTTTCCCGGGAAGGTGGAGAAGACGCTTAACTAGGATGCTCACCGGGT
TGGAATACGGTACGAGCCGAGCGTTCTACGTACTGCATTTACGCATAAGTGAACAAGAAGTCGGCAGATCGAGGTAGGGAGGAGTCGGGTCTACGCGGTA
ATACATGTGACTTGCATACATACACCGCCAAGATCGCGAATCTTCCTAAAATCGATGAGTTCCGCCGATCTGGTGCAGAAGTAGCCCTGGATCTCAAGAA
AGGAGAATCCCGGGGTTACTGGAAATATCATGCACTAGGGAAGTGGTTCCGACAAGCCAAGATCACAGGCAAGATCGATCATGCGAAGGCGATCTTGCTC
CTGGACACTGGCGCCGAGGTATCTATCTTGGATGCCCCCTTTGCTCGCAAGGTTGGGTGCCACTTTGACACTAGTCAGAGGCAGAAATGTGTGAGAATTG
GCGATAACGTGTATACCACAGAAGGGAGAACAAGGATCAAGATCACGCTGGCGGGATATCTGGTCTACTTTTTCGACATATGGATCGGCGATCTCTCGGG
CCAGGATGCGATCCTGGGCATGGATTTCATGATTCCGGCCGGGGTCCGGATGGATCTCGCCAAGGGATCGATGTGTCTACCCGACGAAGTCGGGATCCCG
CTTAACGGCCGCAAGAGATTGTATGGTGACAACATGCGATCAATCCCCTCAAGGAAGATCTGCAGATACCGATCGGGGAATCGGAGGAGGCAGCATCAAG
AGTGAAGTTGGGCGCTACGGAGAAGCTGTGGGTAACCAGAGGAGAACGATGGGTACCCACGGTGGTGGATGGTCCAGGTCGAACCCGGTATCTTGTGATC
TCGAATCTTGGAGAGAAGATCTTGAGGCTAGATCATCGTCTCAACGTCGGAATGGTACTGGATCAAGAGAAAATGCCTAGATCTCGGGGTTTCGTGTCAG
TGGGATCTCGCCGCTACATGGAGTGGCAGAATCTAGCACTGGAAGC