Description :
From Genome Similarity Track
Location :
scaffold_3:2759041- 2760446
Transcript NameFunction/comments
Plaha_PHALS_13184FOG: Transposon-encoded proteins with TYA%2C reverse transcriptase%2C integrase domains in various combinations

Sequence
1405 bases(100 bases per row)
ATATCGACATGCTTGATGTTAGATGCCGAACTTTCTTCTTTCAATTGCACTGTAGCTGCTTGGTTATCGACAAAGAGAAACCAGTTATGGATCCCTTAAA
TGCCAACTTCATCCAACATATTGTAATGTCCATGTAATTCGGTTGCTACGACTGATGCCGTTATGAATTCAAACTCTGCCGTTGATTGCGACACTGATGC
TTGTTTTCGACATATCCATTCAACATCACACCCTCCTACAAATATCACTACTCCAATCATGGATTCGCGGTCCTCAGTGTCAGCAGCGAAGTCTGCATAG
CTGTAGCCGGCGATAAAACCATCAGGTAAGTCTTCAGTTCGCTCTTGATTTCTCATCTTCaacttcaaacattttgttccCTTTAAATATCGTAGAATTC
TTTCACCAAGTTGTAAGTCTTGTTCCCTTGGATCATGGGCCCTTCTCGATCGGCAAATGACAAGTCTGGACGCGTGTAACGCGAAATCCACAACAAACTT
CCCGCTAGTGACCTGAACTTCTTTGAATCGTGCAATTTAAGGCAGGATTTGTCATATAAATGTCTAGGACCAATCGGAATTCTTTTCATTTTTGCTTCAT
TCATTCCATATTGATTTAAAAGGTCATCAATAAGGTTTTCTTGACCAAGAAAgtaatcttcttcgtgtttGATGATTCTTATTCCCAAGAACTTCTTAGC
TTCTCCCAAATCCTTGATTTGCAAGTTTTTCAGTGAATCAAACAGCTCGTTcactaagtcgtcattgGTCCTAGTGACCAATAGATCATCCACGAAATTA
CAACGAGTAAGATTCCACGATCATCCTTCTCATAAAATAAACATAATTCAACAATCGATTGCTTCAATCCCAAATCGATCAATTTTCCGATTCCACCGGC
TTGTTTCAAGCCGTAAAGGCTTTGAAGTAGTAACAATACGATTTCATATACAGAATTCACACCCAActccttcaatacttgatccCGTATCTCCATCCCT
TGTGGAATCTTAATACAAATGGGGAATTCTTTTTCAGCGGATGCTTTGACGTAAGCATTAGGCTTATCTCCGTGTCTAGCTGGTACCTTCCAGTGTTGCG
CCATTGCCAATATCACTTTGGCAGTGATCATTTCCATGACAGGCGcatttgtaagcgtgaaatTCTCACCAAAGACTTGTTCCATTTCCGCATGCAACCA
TTCTTGCTTTGTTTCTTTCTATTCCACCTTGTGCGTTGGTCTTGGTCTTAAATACCCATTTGGTACTCAGTATTTTCATGTCTTCTGTCTTCATCACTGT
TTTCCACGTGCCGTTCTGCTTTAATGAGTCAAGTTCGGACTTAATCGCAACAGTCCATAGGTCGTTATCCTTggtcttcattgcttgattGTAGGCTCTA
GGATC