Description :
From Genome Similarity Track
Location :
Scaffold_38:275861- 278325
Transcript NameFunction/comments
Phyra_95340Hypothetical protein
Phyra_79244nucleic acid binding protein

Sequence
2464 bases(100 bases per row)
TTGCTCGAAAAAAGAAGCTTCGTGAGAAGAAACTCCAGCGGCGACAAGGTAGGATTAATACTTTGGGGCATGGAGTGGAATCGTTGCCGTGGTAACCTCA
ATCCAATCTGTGCTCTCGTTTATGCAGCCTTGCGTCTCGGTGGTGGTGGCGGCAACGGCAGACCTCTAGCTGACGATATCGATGTCAAGCAACGATAGAC
CAGTGTCGAGGCCCACGTGCGCAGTTTGTCCATGTGCACTTCGACTTAGTGTCCTGCGACGCTGTCAGGGCATTCATTGCGCCGAGTGGAGCTCGCACCC
CGTTATTTATTGGCATGTACCGTAGTCGATGTTAACGCGACTTCCCATCCATGGTTTTGACATCCACTGGTGAATGCCAAATTCTTTGCTGCTACTTTCA
AGTAATCGGTGAGCCTAGGACGGGAGTAGTGATGTATTTGTGTTGGATTGATTGTTGTTAGGCGTGCTACTTGCCGAGCGGTGGGAAGTCATCCTCGATG
AACCCACTACTGCCGTTGCCGACTCCGCGAGTGGTAGCATGCGGCGGCACCCAGTTCCCCTGCCGCACCGAAGGGCGGCCTTGAGGCGAAGGGTACCCGT
ACCCACCGCGTCCCATGATCACGGACGGCGGCGGGTTCAACTGGTGATGCTGGAATTGCTGTTGCTGGTGGGGTTGCTGATGCGGGGACCTCTGGTACGG
GCTAATGTCTACTCTATTGTTGAAATCGGATCCGCCAACGTGATAACGGCTGCGACCCGCCGAGCCCATGGACATAGGTGGCGGTGGTGGCGGCGGTGGT
GCGCTGCCAGTCTGTTGATGCTGATACCCTCCATATGACCTATCGTAGGATCGATCGTACTGATGGGATTGGTACTCGTGTCCAAAGCGTCCCATCTGGG
CGCCACCGCCGCCACTAAAGCGATTGCCATGGTATGGTGACTCGCCACCACTGCCGCTCCCACTAGAAGCGCCACCACTGGAACGAGGGCGGAAAACGTC
ATGATTGCGCGTGAAATCCGGGTCATTCAGCTCTTGCTCACGGTTGCGCCACAACACTTTGCTCTCTTTCCAGTTCGCTGCGTTCGTTGCACTTGGATGA
GACGACCGTGAGTACTCGTTACTGCTAGCTCCGTCATTGCCGCTCGACCGTTCCTTAGGCGAGCGGGAATCTCTCGATTGAGGCCCACTGCCATTTCCGC
CAGAAGATGGAGCGCCTCGACCTCGGCCAAAGCCTCTACTGCCGTCCGGACCTGATGCTTGTCGGCTCCCATGTCTGCCACTGTTATTACCAGTGCTAGC
TCCACTCCCACTTCCTTCATGCGCCAAAGAAGTCGTCGACGACGGAGACGACGCCACCGATTCTGCTGCTGAATTTGCAGTCTCTTCTCCAAAAATTCTT
GCTCGTGCTTCAGCGTACGCCCGCTCGCGGTCCTGCAATGTGGGCATGGCTTTATCCGCACCATTACCACGCCCATTAGCGCCAGGTCGGGGCGCACTGC
GCTTCCGCATCATGATTCTCGGCGCAGATGCTGGCGTCACCGTTGGCGTCTGGCGATCGGGCGACAAGTCAATGAGCAGGACGCGAGGCACCGCCGACTG
CGGCGTCTTGAATAGCGTGACCACCCGCGCCGAGCTGTTCTCGTACGGATTGTATTCCGCCGTCTGGTGCTCGAGGCCGCAACGCTGCGCCAACCGGTGA
ACAATGAGTCGGTGGTACGACGACAGCGGGGGAAAGTTGAGGTGCGGCTCCCTCGCGTTCTTGAGGAAGCGCACGATCTGGTCTTCGAACTTGAGCAGAG
TCAAGCGCTCGCGGGCGTTCTCCAGTCCGGCAACCAGCACGGGGTCCAATGGTCCGTGGGCGCTGGCAGTCGCGGTGCCGACGGGAGCATTGACACTGAA
TTGCTGCTGCTGAGGGTAGTTGCCGCCATCGTCAGTTGTTGCAGGCGGTGGCTGCAGAATGCGAAGGCTCTGCAAGGTGCGCGTGGCGCCGTCAATGTCA
CTGACAGTCGCTGGTCTGGCAGCAAGCGAGATTGGCGTGTTCAGGGCGGGGCTCGAGGCGGCAGCGCTCTCCCACGCGTCGCGGTCGTTGCGTCCAGACG
CGGACGTGCGGATCATCGCGAGTGACTCCACACGATAGTGAGGAGGTCGGAACCGCGGAGGTCGTCACGGGGGAACAGAGGCAACCAGAACGGACGTGGC
GGATGGCGGGTCCCAAAGGGGGAAATGAGCTCCTGGAGCTCGTTGGTGGGACTCGAAACCCTGTCTAGTCGCATACAGCATGCGACTGGACAGGTTTGGC
AAGGCTTGTCAGTGTCCGGTTCAACTTGGACGGCCACGTTGTTACTGTCGGACGGAGCTTGCTTGTACTGCTACTTAATAGACTAATTTTACCTGTGAGT
GGTTGACGAGATGGCGGCTGCTCTCGTCGGCTGCTTCTTCGCACGAAACACGGGGTTGACACTG