Description :
From Genome Similarity Track
Location :
Scaffold_11:27582- 29999
Transcript NameFunction/comments
g4020.t1hypothetical protein

Sequence
2417 bases(100 bases per row)
ACAGTTAACGTCGCCGAGTACACCGGGATGAACCACGGAGTCCTCGCGGCACTGGAACGAGGAGTGACTGATTTGATCGTTGTGGGCGACTCCAGGCTCG
CAATCCAGCAATCCATGGGGGTGATAGCATGACCCTGCAAGTGGAACTAGCACGCCACAAAGAACTCGTCGAACGCCTAAATTCAGTCCGCTACCTGCAG
GTCGTCCGCTGCTATAACTCGGCCGCAGATGCATTAGCCACTGAAGCTCTTGAAGCCATGGCAGGACGCGTTGTCCTCAGTGGAGATCGAAAAACAGAAC
TGCGAACGCTAAACCGGATCCAAGAGAAGCTGTACGCCGTCACAGACCTGACCGAAGGAGAAGAAATTCCTAAAGTCTCGGCGACCACACGAAGCCAAGC
CCGTCAGACTCGCCGAGTCAGATTCGCCGGGGATGAGCAAGACGACCCAGCGAATGAACCAACAACGCCAGTAGCGTTAAGAGGAACGACTCGCCAAGGC
TCACCGATGACAGCGATAAATACGGCGAGTTCGAAGAAAAGTACAAGCCTCCAGGACTCAAAGAGTGATTGAACAAAGTTACACTACAATTGAGCGACAA
GAGTGACCAAGCCGCCCAGGACATTGATCCGTTCGCCGTTCAGACGAACGGCGGGAACAAATATCGGCAGCACAAGACGAAAAATACAAGTGCTCAGACC
TGAAACAATACCTGCGACGTGTATTCGACGAGCTCACTCGACGAAGAGCAGGAAACGCAGGCAAAATTGCTGACCGCTTCGTGCTCAGCGAAGATGGCCT
ACTGTATTATCTGGGTCGCCGACGAGAGCGAAGAGAACCCAGCGAAGAAGATATGAAGCTGAGACTGGTAGTTCCGACCACGCTCATCGACGAAATCTTC
GCGAATTGTCATAACTCCATCGAGGGAGGGCACCAAGGTATCGTGAGAGCGTATCACAGGGTGAAGACAGACTATTATTGGATCGGATTGTATGCCGATG
TGGTCAAGCACGTCCAAGCATGCGAAGACTGCACTACCAGCAAGAGAAAACCCTAAACTAAAAGGGTATTCGCCAGGCAACGTAGTATCGGACAGATCAT
TCCAGATCGTGTCGATGGATTTCCTTATACCACTGCCAAAGACTCAGCGAAAGAACACCGTACTGCTCCTCTTCCAGGATCACTTTACTGGATTCGTGAT
CGCCAAGGCAATGAGCGACACAGGGGCACTTGGGGTGGCAAAGGCATTTGAAGAATGCATTTTTCGTCGGTTTGGAGCTCCTTCGCTCCTTCGACACGAT
AGAGATCCAAGATTGATGAGTGAAGTCTTCCAGACGTTTTACGAGATGATGCAGTCTAAGTCTCGAGCCACCTTGAGTTATCGGCCTCAAGCAAATGGTC
AACAAGAGCGTAGCGTCAAGACGATGATCCAGACAGTACGAGTCTACGTAGAAGACCCGTTACAAGCTGACTGGGGTGATATCACTGAAAACCTCGTCCA
CGCTATCAACAACTCAAGAGATTCGACTCGGCGAGAAACGCCATTTTACTTGGTACACGGCTGGGATGCTCAGTCTACACTCAAATCGATGACTTCATCC
ATTCGCTGGGCCTCAAAAAGCCCAGCGAAACAAACGACGTCAGCAAACGCTATAGAATGGCGCAGAGAAGCAATCCGGCAGCGAGAAATCGCACTCATTC
TTGCCAAGGAATACCAACTGAAAGAAAAAGCCCGGCGAGCCAAAGAGCATAACGAATCGTTGAGCCGAGTACAACAGGGAGCTGTTCCTTCAACAAGTAA
CGAAGACAATGGACAAGTAGACGAGACAAACTCAGCGAGAGACGACACAACAACTGCAAGTGCGAACAAAGAATTAGCTGAGTCTACGCGGTCGCTATTC
AAAGAAGGAGACCAAGTCTGGTTGTTCATGGAACGGGTGAAATCAGGATTGAAGAAGAAACTCGCGCACCGGTGGCATGGACCTTTCCGGATCAAGCACA
AGATAGAAGAGTTCGCTTACGATCTAGAACTACCGGACAAGAGTGGCTATCGATTCTACCCCGTGGTTCATGTATCACGACTGAAGAAGGTGACTGAGCT
CAGCGAACGTCCCACGACTGAGCTAGTCGATGGTCTCAGCGAAAACGATCGATTTGACTTCGACGAGGAGTTGCTGCCGGAAGACAGCTGGGAACCTGAC
GAACGAACCGGGCGATACGAAGTAGAAGCCATTCTCGATGATGAAATGCCGCTTTCGACAAGTACCGACCGAGCTCAGCGTCTGTTCAAAGTAAAATGGG
TGGGATATGAACCCACGTGGGAACCATTGTCGAATTTATCGTGCGGAGGCCTTCTGTTCGATTACCTTCGCCAGAGAAACGTGAAAACCGTCTGCAACTG
GTGCAAGTTGCAGACGA