Description :
From Genome Similarity Track
Location :
Scaffold_71:2758- 8660
Sequence
5902 bases(100 bases per row)
CTCAGCAGTATGCACGCTCTGAGAGCTAGTGTCAGTGTGGCCGATGTGCGTCTCGAACGCAAGCTTCGGTATGATTATGCCAAGCTTAAGGCCAGAGTCC
AATTGCGCAATCGCACGCGCTATGCTTCGGATACTACGGTAGCCGCGAGTGCTGGTCAGACTGTGACCACCAACCCGCCAGCCGATACCACTGGTGGTGG
GAAATGGCCTCGGTCTCGGGATGACACTGGCCACGATGTTCAAAAACATCCAAGGAGTATGGGCAATCTTGCCGAAGGGGTATCTCGTACTCCCATGAGT
TTTCCGACTCAGGGTACTCTCGTCACTTTACCAGATACTGGTATTGGCCATGAAGACGACGTCGTTTCAGTAGTCTCTCAACATGAAACTGAAGATTCCC
ATTCTCATCGAGCAGCGTCGGGGGTGGCCGGTGTACCGGTGGCGGACCACGAGAAATTGGTTTTCGAAGTGAAGGGTCTCCAAGAGACCTTGGATAAGAC
CCAGTTCATGCTGGATGCGATGAAAAGCCGCCTTCAGGCGATGGAGCGTGCTCAAACTCGGAGCGAGGCTCAGTTGGACTAGCTGATTCGCTTACAGCAA
TCCGGGGCACAGCCCTCATCGTCGGCGCAAGCGCCTCCAAGTTCAAATGGGAAGGTCCCGGTATGGCTTAAGTACGCCTACGTAGAACACTGGGTGTGTG
CGCAATTTGCGCGGAAGGTTTAGCGTATACGCAAGTCCCTTCTTGGCAGTGACCGTAAATGGTCCAATGAAGTGTGGACGAAAATTTGTCTTAAAGACAG
CGGACACTACATTTGTAGGCAGGTTTTTAGCATTGAGTAATACTTGGTCTCCGACCTTATAACGTTCAATACAACCTCTGTTTTTAGCATCTGCTTGTTG
TTTTTGTTGGTCTTTGCTTTCAGCCATTGCGTCACGCACATGTCTTAAGACATTCAATCGCGTTGCGAGAAACTCGCATGCCTGTTTTTGAACAGTAGCA
GGGCTGATATCAGCAAGCCGATTGGAAACCTCTTCCCCACCAAGCCCTGAACCACATAGTGCTAGCGTTAACGGAACGCGAGGGTGGGTGAGACCGTTTA
CGTAGAACGGACTATAGCCTGTAGAGGTATGAACAGCGTTGTTCAACGCAAACTCAACAACAGGGAGAATGGAGCTCCAATGCTTAGGCGTATCAGCGCA
AACACTGCGCAAAATTTAACGATGGTCAAACTGAGCGCGATTAACACGCTCAGTTTGACCATCGGTCTGCGGATGATCCGCTGTGGACAGGACCAAACAG
AGCCGACCACCTTGAAGATGGACTTCCAGAACTTCTCAGTGAAGCGGGGATCTCTTCCAGAGACAATTGTTACTGGCAATCCATGTTGTCAAATACACAG
TCGATAAACAGCTTCGCTGTACCCTCGGCATCAATAGAGTCCGGCACTGCCGCTAGATGAGCCATCTTGCTCAATCAGTCAACAAAGACCACAATTCCAG
TGTTGCCTTCCGAATCTTTCGGTAGGCCAAACACAAAGTCCATACTCATGGACTCCCAACACCCAGTGGGTACAAGTAGACTAGCCAGCGGCGCCGCCGC
ATGTGCTGAGGGTTTAACCCGTTGACATGTTTCACACGTACGCACATAGGTGCTCACCCACTTGTATAGTTTGGGCCACCAATAAGCCTGGCTCACTGAG
CTATAGGTCTTCTCACGACCGAGATGACCACTTAAAGCGGTATCATGTGCCTCATAGAAGATTCTATACTTCAACTCCTCATCATGAGAGACAGCGATAC
GAAAGTTATCCTCAATATCTGTGCGACAGCACAACAGGACATTATCGATAGAATATCGATGAGGCCTCCCACGTAAACGTGCCGACAATTCTATGTCCGA
GTCTTTAAACTCCTCGCTCCCAAGAGCACGTAGCAAAGCTACACATTGTTCATCCTTGGCATCAGCCGCACGGATTAAGTCAGTGACTGACGATGACAGC
GTAGTGACGTGAGCAAGCTCATATTCAGGTCGGCGCGATAGCGCATCAGCCAAAGCATTTTGCTTTCCTGGCTTATACTTCACTTCGAAGTTATATTCGG
CATAGAATGAAAGCGAACGAGCCATTCTCTGAAAGAGATGCGGCGACTGTGTCGCAGTGCGCAATGATGCATGATCTGTATAGATCACAAATGGCTTTGA
GCCAAGCAGATGTACTCTGAATTTGACTAGAGCGTACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTTTCAGCAGCTTTGAGCTGTCGA
GATTTGAACTCAATGACGCGTTCGCGTTCATCGACATCTGTTTGTAACAGAGCACTGCCTATAGCAAAGCCAGATGCGTCACAGACGACATTGAAAGACC
GATCAGGATCGGGCAAAGCCAGTATTGGCGCATGAAGAAGACTTTCCTTAACTGCTTGAGAAGCCTCATGTTCGGTGTTACCCCAACACCAATCCACATC
CTTCTTAAGGAGATTGTATAATGGCCGAGCCATATCTGCGTAATTCGCACTATATTTATGCAAGTAATTGGCAAGGCCAAGCCACTTACATAAATCTTTT
TGGTTATTTGGAACCGGCCAATCGACTATGGCCCTTACCTTAGCGGGGTCCGCTCGAAGGTCTCGCTTCCCAATGAAGCACCCCAGAAAGGGAATTTCTT
CTGCACCAAAGATGCGCTTAGATGCATTTGCATACAATTTATTCGTGCGCATGCACTGGAGCACCGCTCGTAAATGATCAATGTGATTATCCACATCAGA
TTGACCGTTCGTTGCACAACTAGGGACAAAGATGTCATCAAAGTATGTTTGTGCATAGCCTCGATGAGGTCTGAATAGTTGCGTCACTGGGCGATGATTA
AAAGTAGCCGGGGCATTTTACAGCCCTTGTGGCATAACGAGCCGCTACCAGAGCATACCGCTCGGGGTACTAATCGCTGTTAGCGGAATATCGCTTGCTC
GCGTGAGCTGCTGGTTATAACCATCGACTAAGTCGAGCGCACTGTACAATGTACATCCCACCATATTGTTCTGAAGAACATCCTTTCTGGGGATTGGTGT
CTGAGCCGGGATAGTGGCAGCATTGAGCTTATTATAAATGTGCACAATACGCCACTTACCATTAGGCTTTTTGACACAAAATGCAGGTGTGGAATGGGGA
GGCTTACTCTCTCGCACCATTCCCGCCGCGTGCTTAGTACGAAAGAAATCGTCAATGACGTCACGCTGTTCCTTAGGTAAAGGCCACTGCCGTGTTACGC
AGCATTCAGTTCCTGGAACTAGGTGAATTTCATGACGTACACCTCTATCGGGACGTAAGACAGATGGTGTGTAGTGACACACCACATCTTGAAATTCCTT
TACCAAAGGATAGAATGGATCCAAAGTATCCTTAAGGATCGAAGATCCACTCCGGGCACTGAGTGCCGCCTTGGTGTCCTCTAGGACCGACTCATCCATT
AATGAGGACGAGTTCAACTCGACATCGGGTCTAATGACCACTAATTCGGGTAAAGCTCTTGCCTTCAAGGCCTGGCTAAACTCGCCATCAGACATTTCGT
CTAGCTCACAAAGAGCATCCAAAGATGGTAGGGTTTCCAGGCTAACATTGCCCTCAACCTGGTCAGTCACTCCGTTGACAAGTGTATATAGTGTATTACT
ATCGTCACTATGTGACTGCTCGGACGCCTGGCGCTTAACAGTTGCGACCTGGCATCCAGGTCGTCTCTTCGATGAGACCTTACACCCCTCTGGGGTCGGG
ACAATAGTGTCCCCGTGGTTACTACTAGTAGTAGTACGCTCTATACGAGAGCTGATGTCTTGATCGACATCCGGTGAAGTGTTACGTAACTCGAACACTT
CACCCAGTGGATTTAAAAGTGCCACTCCACTTACATTATACGGGCCTAGCCCTGAACTTAATGGCGTTTCGCCAACAATGTCATCACCGACATTAAGTGT
GGTGCCTTCATGGCCGACCGCACTCGATGAATTTTCACGTGCCACCACACACACATTAAAGGAATCACATCCTTGATGATTCGGCCCTAGGCCAACCATG
CTTTCTACATGCAGTGACTCGTTATCACAACGAGTAACACTCAACGAGCTACGCTCGGAATTCATGTTTTCAACATTGAAGTTAGTTAACTCAGACATTC
CAATGTCCAGCACATTGGCATCTTCTGTCAGAGGCTCGCGCCAATAGTGCTTTTGTTGCCTAGCAAAGGTGGGTTCATGACTCTCCAAAACTTCGCTAGG
AGCATTGCGCGTAGCGCCTAAGGTCTTCGACCTCCAATCAATCTATGGCTCATGGCGTTCAAGCCAAGCCATACCTAAGATGAGATCATATTGCGAATCC
AAATCAAGGACAAGACAGCGTTCAATGCTATCAAAGTCCAAAAACTTTATACCTAAGTTCAACGGAACTTTAGGTACAGTGACACGACTTCCAGTCGCTA
AGCGAACCGTGATTGAATCACCCTCATGCGCTGTAAGCGCTTCAGCATAAATCTGACTTCCCTCAAGGGAAAGACGTCGGGCATAATTTCAAGACGCCCC
ATAATCGATTAGAATTGACCAAGGCTTTTCAAAGCCTTTAACAGTGACCAACAAGCCAGCCTTGTATCCACGCTCCATACCAGTACGTATGGAACTCTTT
CGGGCTAAGCCCTGTTCAACTTTACCTCCTAAAGGTGTTACAGACCTAGTTCTTCCCCAGTAGGGCGCCCCGCGCCTACTGGGTGTCGGCATTTCCCCGT
GCCATGCCAGACTTCTGGCTCGGGGTAGAGTGTTGACTCGTAGCCTGGCGCTGTTTACGCAAAGGGCAACCAGGCCGTAAGTGTTTAGTGCTTCCGCACG
TATAACACCTTCGTACAACACGTTGCTGCTCAGCAGCTTAAGGTTCAACTTCACCTTCATCTTCAGCATAGCTGAGATCCATCGGTTCTGGTCTATTAAC
GGCCGGAGTACTCGTGCAGTTTGCTCTCGCAGAGCTAGGGTTGTACCCATTCCAGCCAAGTCTGGCCGACTTGAAGTTATGCTCAGCATTAAGAGCAATT
CTCACAGCCTCTTCGAATGTAGAGGGATGAACCCGAAAGACTTCGGTTCTGGAAATGCCAGTACGGAGACCCTCCATGAATATAGTCACATGGACTGCCT
CAGGCAGAGGGTCAGACTGCATAGCAGCCATGAGAGTTCTCAGCTCTTGGACATAGTCCGTTAACTCATTCTTACCCTGACGGGTTGATAAAAAGCGTGA
AAGCACGCGGTAAGCCTGGTTAGGTTTTGAAAACACCTGTATTAATTGTGACTTAAGCGACTCCCTTGTGGAAAACGCTAAGTCGACCGACGTGCTACAT
GTCAAAGCCCATTCTCTAGCTCTTCCATAGAGCTTTGAGATAGCCAGCGAGACCTGTTTATGGTCAAGCTTGATCAGGCCTGATCTCATGGCCATCTCAA
TCTCACGGATCCAGAGGATGAGGTTTTCACCCTCCTTTCCTGAGTAGTTTTTAGCTTCCACTTAAGTGGACGAGGCCTAGACTCTTCATCTGGAACAGAC
ACATAGCGTGTAGGCATAGCCGACGACATTTGGTCTTGGACCTGCCCTAGAAGGGACTCTTCATACTGCAGGAAGCCCTCAACACGTGCAGTCAGCACCT
CCGGGCCTTGCGATACAAGGAATTCCACATACTCTGGACCCAAAGATGCGGTCAGCTTATCAAGCGCGACCTTTGGGGCCTCAGAGAGGGGAGTGGGGTT
TTCCATCCTCACAGAGGATACGTCTTTAAAGACTCAGGCGTAGATTGACTACAAGTGCTACCAAGTGAAGCGGGGCGACAGAGCTCCTTAAGTCAGAGGA
AG