Description :
From Genome Similarity Track
Location :
Scaffold_1466:2758- 3849
Sequence
1091 bases(100 bases per row)
TGGAAGTCCTCGTCCTTAAGCTGGTACAGCGCTGCTCCATAGACCGCGAAGTCTTGGATGAAGCGACTGTAATAGTTGAGTGCCCCAAGGAAGGACTGCA
TTCCTTTCCTCGTTGACGGGAACGGAAGCTCGGCCACCCCAGCCAGCTTCTTAGCGTCCGGTCGGATACTTTCTGCCGAGAATTCGTGGGACAGGAAGTC
TACCTTGGACTGCACAAAGATGCTCTTCGTGAAGCTGATACTAATACGGCACTCTTCAAACCGTGCCAGCAATCGGCCTAGCGTCGCCAAGCACGACTCG
AAAGTCTCGGCACCGAAACAGATATCATCCACGAATAACCGGCGACTGAATACTGGTGTCAACGAGGAGTCATCGGGCTCCCCGTTGGCGAACATGTCGG
CGATAGGGCTGCTGACCAGTTCGGCTACAGCTCCCTTACCAAGCGAGTTGTCTCAGTCGGCCTCGAACTTGGTCCGGAATGGCTTTGCCGTGCCAGTCGA
AGCTTCGTTCACCCCAGCATGAGCTTCCTTGTCATGTTCTTCAGCTAGACGCATGCGCTCCGAGAATTTAAACCATCCTCCCGTCGGTTGGACGAAGCCC
CAAAGCGCGTTGTCAATCATGCGTTGATAGATCATCGGTGCGTTCTTCAGGCCGAAAGGCATACGCAACCATTCGAAGTGCCCCAGTGCGCAGACGAAAG
CAGAGATCTTCCGAGCTCGTTCGGTCATCATAATGGCCCAGAAGCCGCTAGCGGCGTCAAGCGAGCAAAACCACAAGTACGCCTCCATGTCCGTCAGCAA
GTCATCCACCAGGGGCATGGCGTACTCCATAATCTCGGTGATCGCATTAACGAGTTTGTAGTCGATACACAGGCGGATATCCACCCCATTCTTCTTCAGG
ACGATGACGATTGGCGACGCCCATGGGCTGTCCGAGAAGGAGATAAGCCCGGCCTTCAGCAGACCCTTCAGCAATTCGTACAGCTTACCGAGGAAGCGAA
GCGGGGTCCGCCGAGCCTTCTGCTTGATTGGCGCTTGCCCCTGTACATTGATGTCACACACGACCCCGTAGGCTGGAGGCGGCAGGGCGTT