Description :
From Genome Similarity Track
Location :
scaffold_83:27568- 32211
Transcript NameFunction/comments
Pl_110179Sulfate Permease (SulP) Family
Pl_110180protein kinase, putative

Sequence
4643 bases(100 bases per row)
TACGTGGACTACACCTCTTAGGTCTCATTGGCGGCCAACCAAAAGACAACAACTTGTATTACCGTGGCAATGGCTCCGACTGCGGGTGCGTTACGCTGCT
TCTAATCCCTCTCTACGCACTTTCTCAACAGTTCTTGTATCATCTCCATGTTATTTCCATCTCAGGAACTCGTCTCCGCTTCAAAAACGCGCGCTCCAAG
AAGCCACAACAGGCCAAGAAGGTTCCGTCACTCAAGAACCGGATCCGAGGCCTCGAGCGCTTCCTCAGTCGCGGTGTACGTTGGTATTGATGGTATAATT
ACGTTGCAGCAATTGCAGCAGTTAATCAGTTATTGGTTATTGTGTGTGCAGGGTCTGGCTGACGCCACTCGGAGAGCCAAGAAGGCAGAGCTCCAGCAAC
TCAAGGAAGAGGTTAGCGATACACAGTCTACCAAAGCTTTAGAGCTGAACGTGTAATACTGAAAGAAAGTATTGTTGTATGTTAACAGCACGAGAAGAAG
GAGCAAGTTACTCAGGAGAAGAAAAATGTCGAAAAGTACAAGAGAGTGAGTAGCTGTAGTTGAAACTCGGACATACCTGTAGATATTTTTTCTTGTGGTT
GGTCGCTAAACAATGAGTTTGTGGTTGTGTTGTGGCATATTAGCCACGGTTTTTCGAGCGTGTGAAAGTCATGAGAAAGCTCCGACAGGCGAAGAACCGC
ATTGAACAGGTAAGGACGTTTCCCGTTGATGCAGGTTTTAATGTGCTAGTTGGTGGATGTAATACTCATAATACATTGATTGCTGCAGGCGACTGATGAC
TCGGAGCGTGCTGAGCACGAAAAGAAATTCAAGACGTACCGTGACGAGATGATGTATATCTACTACTACCCGAAAGCTGAACCATACATTTCACTTTTCC
CTTCCGCACCTCATACAGAGGAGAACCAGAAGCGCCAGAAAGAGCTTCGCGCTGAGGCAGTTGTTCGCTTTGAGAAGGAACAACCTACTGAGGCATTTCA
CCAGTTTTGTTTCAACGACGGCAAGGGTAAGGATGCCAGCTCTGCCAGTGAGGCTAGACCTGCTGTAGAGTTACTGCTCAAGAAGCCCACGAAAGAAATG
CTAAAGAAGCAAAAGAAGACACGCAGCAAGCGTGATAAATCCGGTGAAAAGACGAAGCATACTCCGGCCCTTGTTGACCAGGAGGACGACGACGAAATGC
CAGATGCAAAGGAGGAGAGTGGGAAGGAAGAGGAACAAGAGGAGGAACAGGAAGATGACGATTTCTTCCTGTAATTGTTGATTTAGAACACGAACATTGG
ACAGGAAGTCGCCATGGTCAGTGAGGTCGTTCTTTAAGTATTTGGGTGGATAGGTACTTGTACCTTTCACGGTCACGTGGTTCTTGCAATTTATTACTAA
TAGTCTTTACGCTGACGAGCTCACTGTAAAAAGAATAATGAGGGGGTAACTGGAAGCATCGTCGAGATCAGGAATTCGGCTAGATCAAGATAGACGGACC
AGACGCAGCTCCTATAGCTTGCTGTTCCGTATCGGTGATCATTTCAGCTTCTGCTTGTGATGCAGCGGCGAGTGCATTCATGTTTGTAAAACTGAAAGAC
CTGAAGGCATCTGAAAGGCTGGAGTCATCTGGACTACCGTACATTCCACTGGGGAACCGATAGTGACTGTTGTTGTCTTCCAACGTCTGCACTTCTTCCA
TACACTCATCATGCGAAGCACTCACCGCATCAAGCACATTTAATGCACCTTCGATTCCCCACGACATGTCGACATCCACCATACTTGCTGATATACTATT
ACTAGTGTTGTTGTTCCCAAAGTCACTCCGATCTTCTCGTTTGGGGACAGATGGACTCAATGGGTGATCGTCGCTTTCAGATCCCGAGTCAATGTTATTC
TGGCTGCTACTTGCGGACTGAGAAGCACCGTCGAACTCCTCGTCATCGATGAAGATGTCCGTAAGGTTGCGATTGTTGAAATAACTAGTATCGTTCGGCC
CCTCCAGTGTCGGCACGAATGGAGGCACAGATTCCAGAATCGTATCCCAATTGATGCCCTCAAAAAACGGGTGAAGCTTAATACCCTCCCAGTTCATACG
AGTCGCTTGGTTTGGGTCCAACAGTTTATCTATCAAGTCCACAGCCTCGCGTGATAAGCACTTCTCGCCATCGGGCCACAGAATTTGCCGCTCTAGAATG
TTCTCGAAGATAGCATCCACTGTGTCATCATTGAAAGGGGGGAAACCAACCAACATTTCGTAGAGGATGATTCCTAAGGCCCAATAATCCACAGGTGGGC
CATGAGGAACACTAAGTATGATTTCAGGAGCCAGGTAGTCCGGAGTACCGCATCGTCCGTATGTTTGATACGCTGATTTCTTTTTCGAGCTCCTCTTAAA
TGACAAGGTACGCCGTGGACCCCTGGGAGCTGAAGCAGGCGGCGCATCTCCCAACGTTGTGTCTGTCAATATCTCGGAGTCCTGGGCCATGGACTCATCA
TCGGGCTCCGAATCGGTGTCACTGATTGCAACAGCTTCCTCAGACAAGCCGAAGTCAGTCAACTACAAGAAAAACATTGTTTATACAGTTAGAGGCGATA
CGATAATGGTGGGGGCTGTCGCTCAGCCAAACGCACCTTAATGTGGCCGGTTGATGAAAGCAAAATATTGTCAGGCTTCAGATCTCTGCATAATAATTTG
TCAAAAACCAGACAAGTGGATAGACAGACGCATTGACGAGTGAGACAAAGCACTAAACTTGCCAACCAAAGTACGCTTCGAACCTGTGAACACAGCCCTT
AGTGTGCAAGTGATTGAGTGCAATTGCAATCTCCGCAATATACACACACGCCACCTAAAGCCAAACACACCGTTCAATTGTCAGCACCATTGAAAACTTT
ACGATGTGGATAATGCAAGCTTACCTGTTCTTCGAGCTGCACAATGCACTCCAGCAACGACATAAAATCACCACCAGGAAGATACTCCATCACCAAAAAG
AGATTGCGCCTAGCGATACAAGATAAATATCCTCAAATATAAGTTGGTGTTCACCTCGAATATGATCTTACTACTGCATCGCAAGCATGGACTGCTTACT
TGGTTTGAAACGTCCAGAACAACTTCACAACAAAAGGGCTCACCACACTGGCCAGAATATTCCTTTCTGTCTCAATCTGCTGAATCTGTGGTGGCACACA
AAGCGAGGAAGGACCAAATCCTCAGTAGGCAGCACTATTGTAACGAGCATGCTATACATCAGCTGTACCTGCTTTTTGCGCAGTAGGTGCTCTTTCGCGA
GCACCTTTATCGCATACTGGTCGCCAGTTGTCTTCTTCCGGGCAAGATAAACCTTACCGAAAGCGCCTTTCGAGATAGGTTTGACGATATGAAAATCACG
AATAGAAACACGAAAGGAAGCCGGCTTCAAGCTCGATCGTCGTGATGGCCGAAGTCCATCGCTGACTTCGATAACCTCCAGTGACTTTGTTCGTTTCAGC
GGCGCCCGTGTATCTTCAATCGGAGCCTGCTGGAACATTACCTTGTGAGACGCACGCATTTTGCTCATCTTGGCATGTATCAAGTTGCGCAGCTTGGTGC
AGTAGTTAAGTCCTTGTTCAGATGTATCCACCTCCTGCTGTCGTATTCTATCGATAATCTTCGTCAGTCGAGCACAGAGTGCGAACGCATCGACACTGGT
GACATCACACGTAGACGCTTGAATCGCCACAACACGTAGCGCATGATAAACATGCATCTCCTCCGGGTTAAACAAAGGTTTCGTAGCTTCCGCTGCTAGC
GTCGCGTTGATTGACGACGTGAGTTTCACCAACGAATTGTTAATCACGTCTGCTTCCAGTTCCACTCTCTTGGACAAGACACAAAAGTTGATATGTTCAT
CTAAATGGTTGGTATCCACTTTGGTCTCACAGAGTTTACACACGACCACTGACTTGTTAGCTCGTCGGAACTTGATTGTCATCGGTCGTTTACTGAACTG
CAGATTATCCAGTACGTCTTCAGGTGACATTGCGCTCACATCTTGTCCATTCACTTCTTCCACTGCCAAGCCTCTCTTAATGGCGATTCCAGGTGGAATA
TTCACGACAACACTAGCCCACGTCTCTGTGTGAACGCTTTTGATCACAACTTTATTCTTCAGTGCGTCAAACACAAATTCCAGTCCCAGAAATCCGTCTC
CAAAGGTGGCATCGAAGGTTTCCGCTCTTTGGACGTTCTCGAACAGATCTCCTCCATCCTCAATCATAGCCGCCGCGTCGTCCACGGCTGACGCCTCCTG
GTTCTCCTCACTGCCGTCGTTCGACGCGAAGCGGCGCCACTTGACCTGATTCTTCTCCCAGCGCGTGAGTACGTCCTCGAGAGCGTCCGGCGCGGCATCT
AGCAACCCGCTGCGGGTGATCGAGTCTCCGCCAGCGCTAAAGGGCGGCACATTGAGTGTGTATTGGCGCTGCAGACGCTGGGGCTTGATCTCGAGCTGCA
ACTCTTCGTGGAGACGTTCGAGATCGCTGCTGCTGGTGCTGCTGGCGCTTGTGCGACGTCCAGTGTCTGTAGGAAGCTCGAGCTCCGCGACGCGGGCCAG
GGCGAGCTGCTGTGGCCGCTCGGCCATGAGAAATGGAGGCGAG