Description :
From Genome Similarity Track
Location :
contig_39:275650- 276714
Transcript NameFunction/comments
g8569.t1hypothetical protein

Sequence
1064 bases(100 bases per row)
CTCAAGTGCTTGGGGTGGAGGTCGACGGGAGGCTGCAGTCCGTTCGGCCCACGCACGCCTGAAAACGACTTCACGTGCATGAAGCTCGTCCCGTTCGGCC
ACTCGGGCTACTGCGAGGTGGAAGATATGGACACGGGCGAGCGATTTCGCGTTATGCGCCGCTACTGCAGCAGTTCCAAGTGGGACACGAGTTTCCGCTG
CTCCGATGCCGCGAACTTCGTCAACTTCCACTACAAGGCGCGCGACGCCGCGGACGAAGCTCTTGCGCCGGGATTTGCGCTGCCCAATGTAGACGCGAAC
GCCTCAGATGAGCAAGACCCGAAGCGGCGCGACGGCATTGTGATGGTCGTGTACCCGAAGCTGATCCCGAGCGCCTACGCGACGATCAAGACGCTGCGTG
ACGTGCTGGGCTGTCGACTTCCGATCGAGATCTGGTTCCGGCGCGCAGAGATCAACGCCTTTCCCGATGCGATGAAACCCTTGATGGCGCTGGCTGCGGA
TAACGAGACGTCAGTTATCAGCTTCCACGAGATCACGGACTGGCACGCAGCAGGCTACGGAACCAAAGTGTTCGCGATTTACAACAGCTACTTCGAGCGG
ATCCTGTTCCTGGATGCGGACAACGTGCCCAGCAGAGACCCGACGTTCCTCTTCGCCTCGCCCGAGTTTGTGGAGAAGGGGGCAGTGTTCTGGCCCGACT
TCTGGCACCCTGGCCGCACCATTTTCAACATCCACGGCCAATCGCTCCTCTGGGAACTGCTGGACATGCCGTTCAGGAACATGTTGGAGCAGGAAAGCGG
CCAGGTTCTGATCGATCGGCGGCGTCACGCGGAAGCGCTGGAGCTCGTCAAGTTCTACACGTTCCACCGCCCGTCGCATTTCGACTACATGAAGCTCGTC
CACGGCGACAAGGATCTCTTCCGTCTCGCCTGGCTCAAGCTCGGCAAGCCCTTCCACATGATCCAGGCCTATCCGGCCTTGGCCGGCAAGGTTATTAACG
AGAGCTTTTGCGGCCTGACCATGGTACAGCACGACGCACAAGGCGAGGTCCTCTTCTTGCACCG