Description :
From Genome Similarity Track
Location :
Scaffold_827:2756- 7060
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_827-abinit-gene-0.18Ankyrin
Pytiw_DAOMBR242034maker-piw_contig_827-snap-gene-0.6Conserved gene of unknown function

Sequence
4304 bases(100 bases per row)
ATCTCACGAGCGGAGTAACATGCTCAACATGAACATGCAGAACAGGTCTTGATTTTTGCGCTTTGACATTGGTTTCGGAATGCTGGTCATGAGTTGTCAA
CTTGATGGCGGCAGCCAGCACGCGGACAATCAAAGCAATTGATAGTCGGGAAACAAATCCACCCACCTCAACCAGCCATTGGTGCTGGTGTGCTGGTGCT
GAACACACACCCTTATCACGCGAAGATTCCCCACACAAACGTACCCACGACTGTACTGAGGAGAGGTTGGAAGGTGGCTGGCATTTCGAGCTATCCTGGT
TTCCAAGTATCCACTTCGTCTTGGGCTAAGCGTGTTGGCTCCATTATGCGCTGCCATGCCATGAAAGGGCGAGGCGAGTGGCCCCATGATGTAGAGGGCT
TGCCGCGCGTTCGAGTTGGCTGTGTTGACCGTGCGTCCGAAGATACTGCTTGGAGAGGGCGTTTACTTGCGGCTTTGTTGGCATGGAGCTCGCGGAGGCT
TGATGCTGGTCATCGCGAGTCAGCGCCATTGTTCGCTCTGGGCATAAGTAACTGGTGCAGGAAAGCCGAGACTCGGTTGTCGCGGGCGGATGGATCCGGC
AGATGCCTGGGCCGCTTCATTTTGGGGGGTCGCTGTGCCAGACCAGGAACAGCACAGTGGCACGCAAGCCCCATAGTGGATACTGGTGAACGTTGTAGGG
CTGAGAGTTGGAATCAGGGTGGGCATCGCGGGTCGTGTTAGATCCCTTGAACGATGGGTGCTCGTCGTNNNNNNNNNNACCAGAGCTCATCCATACGGAT
ACTTCACTGCTCTTCTTCAGATGACAGCCCAATCGACCAGCACTCACGAAAGTGTAGCCAGTCCAATCGTGAGTGATAGTCTTGTGGGTCTCGCAGTCTT
CCCAGTCTCACATTTCTCGCAGCCGCGTCTTATTGATTTGATCAACGCAGCTAGAGCTCAAGCCAAGTCGATGGCCACTTTCGCGTACAGCAAACCAGAC
AAAGCCGCCAAAACGGACGAAGTCACCACCGTTGGTGTCGCGGTACTGGGCTCTCGGGAGCTTTGGGACGTCATCACGAGCTTCATGACTGGCTTCCCAC
TCGCCGTGCACGAGTTCTATAGCGAGAGCGACCCGATGATGCTTCAGCGCGTGTACGAGGGATGGGGCCGCGACCGATACCTCTTTGGCTCGCTGACAGG
CAGGGGCCTGCTGCTGCACCTTGCGATCGCCGCCAACGACTCCGAGATGCTCACGAGACTCTTCAAGCTCGCCAGCTATCCCCAGTACAAGCGAGACCGA
CGCCTGAGTTGTAAGAAAGCGATGCGCTGCGCTGTGTTGCTGAATCGCGTGGAGCTGCTAGCGACCATCGATACGTTACGCAGAAGTGAAGATCTGAACT
GGACGTGGGAGCCCAACCTCATGCGGATCGCCCTCCAGCACGAAGATCCCGACCTGCGAGTGCTCGATTGGCTGGTCGCGCGCCTTCCGCTAAAGACCAA
CAGACTCTATGAGCGAGACATGATCTTCCACACCACACAAGGCAACCTCGCGGTCGTCCGCTGGCTGCACGAACACAAGCTTAAGATCCCAAAGCGGGCG
CTCGAGCGAGCGGTGAAAGGCGGACACGGCGACATGCTGCGCTACTTCTACGAGCACAGCGCCAAGCGCTGCGATAGCACGGTGCTGGACCTCGCGGCGA
ATGCTGGTGACGTGGCGATCGTTAGGCTTATCATCGAGAATCAGACAAAAGATGTCAGCCAAGATGCGATCTACTGGGCAGTAGTTTACGGCCAACTGGA
CGTGGTCAAGTACCTCGTCGCGAGCAAGATCCAAGAACGCTCTCATCCATATATGATCGAAAGAGCAGCAGCGTATGGGTTCTTCGACGTCATCAAGTAC
CTGCATGAAGCGGACATTGGTGAATTCACAGCGCACGTAATGCATGAGGCAGCCGCACACGGCCAATTGGAGATTGTCCAATTCCTGCATGCGAACCGCA
CCGAGGGCTGTTGCCCCGACACCTTGGATCGAGCTGCTCGGAACGGTCACCTCGAGGTTGTCAAGTTCTTGCACAGGCACTGCACTCTTGAGTGTACAAC
TGACGGGTTCGATCGGGCTGCGTCGAATGGACACCTCGGAGTGATCCAGTTCCTGTACCAAGAGCGAGGTGAGCGCTGCTCAGCGAACGCGACGACCTGG
GCAGCGGAGAGAGGCCACTACGACGTCGTGAAGTTCCTCTGCGAGAAGAACCTGGACGCGGAAATCGCTTGCGCTCTCAAGAGCGCAGCGTCGAAATGCC
ATTTGGAGATCGTGCAGCTTCTTCACTCGAGGTTGCAGCCCGGGGAGTCTGCTTATGAAGCAGTAGAAGTCTCAGTGCGCCAGCGCAGCATTGTCCAGTT
CTTGTGTGAACACCAAGAGCGTGAGCCTGTGAGGTTCTTGCAACAGGCAGTGAACCAGTCTTCGGCAAAGGTTGTACACGCGGTGTGGCAGTACGCGAGC
CTGGAAGAGGTCATCGAGGCCAAGACGAGCGCTGCCTGCGAGAACAAGAGAGAGATCGCGACTCGGCTCGAGAAATGCGTCTGGATCAAGATGAGGCAAG
CAGCTAGCGCTTCGGCTAAGAAATGAATGAGAGCCTCATAGATACGCTATGAAGCAAGCCAATGCACGAGTAGGGACCTTACAAGCAGTGTTGAGCTGAC
CAACTTCATCCATCTCTCAACGAGGCGAGGTTCGACCAGCATCTTATCAGTGTACCTCATGCGAAATAAAGAGAGCAACGGCGTTCCATTTGACAAAGAA
CCCCTGGCTGGCCTCTTATTTTATCGAGGAGCTGGAGCTGAAGCTGGAGCTGTTACAAGCGATCAAATATCTGGTTGGTCGAGGGTAGCCGTGTGCTAAC
GGTGGATGTTTCGTGCACGATGTCGCGACCAACAGAGGCCACATGGACGTCGTGATGCTCGTTATTAACAATCAGAAGAACGAAATGCGGCGGTGTTTGC
TGAACGCCGCCACCAAGAACGGGCACCTGGCAACCGTTAAGTTCATTTTCGAAGGCGCTAGCTCGAAATGAACTGTGTTCATCTGGAGGCGGTGGCGATG
ACACGAGTGGAATCCTTGAACTCATCAAGTACCGGCACAAGCACCACCACAGTGCCGAGTGACGCAAATCGCAGCAAAGGGTCACATGGAGTTGTTATGT
TGAATGTTTGCCTATATGAACCACTATGTGGAACTTTAGGTGGCTTTACATGGCTGAGGCCACGCGCAGACTGTGTCGGGGAAGACCGAGTCCTTGAGGC
CGCCCATGAGGTAGAAGAGCTCGGCCAGCTCGCCGCCCCCCCGGTCGAGTTCTCCCAGATCTGGTTGCCTCAGATCAGCCATGCGATCTGCAGCGGCAAG
CCTGGCGAGTCCGAGCACAGCCGCAGGACCTCGGCCCATTGCATTGCTGCTTTGTGCTCACTTTACTGCTGGTTCCGATACGACAAGCTGCGTTTCGCTC
CAGATACTCCCGCCCATATCTGCTTTAAATACACACCGAGTGGCCTTTTCTTAGCTCAGCAGCTCTCGATTTACCACCGAAAAGCCCTCGCGCCACTCGA
ATAACCGCAGCTTCTTGCTTGCGTGGCCTATCCGAGTGGCTAAAGGCGCCTCACTGGCCTGGTCCAATCTGCGCACGACAACGCAGAATGGCGACGAGCG
AGCGCGTGACCGCGTTCCTTGCCCACGCGAGCATTGTCGACGCGCTCTGTGCCTCTGGAAGTGGTATCAGTGGAGATGGCGACGAAGACGCAGCGGTGGA
CGTCGTGGACGTGCTCAACGAGGTCGCCTCGCTCTCGGAGCAGTACATCCCGACGCTCCAATTTCTCATCCGACCGGACAATCGTACGTCTTGATAGCCG
CCTCTCATACAAAAGCTACATCATGTAATACGAATTCTCACCTCAGGCCTTGATCTTGAACTTCCCTTCACAGTCACAGCGCTCGTGCGATGCCTCGTCC
AGCCACCTACATACCCAGCCACCGCCGATGAAGACAACAACTCCCGAGCAGCGTCGCTCGGTGAGCGCAGGGCGCCCGGCGGCGGCGAGTTTCCGTCCTA
CGACCAGTACGCGCTCATGTTCCGCGCGCACTGGGTGCTCTGCGCCTCGGGCTTCTCGTCGCAGCTCATCGCGGCGCTCGTGGGGCTTCAGCAGGACGCG
CGGGACGCGGTCTGCAGCGAAATCACAGCCTGCAACTCGCGCGACACGATGAACCTCGAGGCGCTCGCGCGGTTCCTCAGCGCGTTCATGGACCAGTACT
CGCC