Description :
From Genome Similarity Track
Location :
contig_50:275449- 282192
Transcript NameFunction/comments
g8454.t1glycosyltransferase
g8455.t1glycosyltransferase

Sequence
6743 bases(100 bases per row)
GCAGGGATGGCCATGACGCCCGGTGGCAAGATGGACCGCCGCCGCGCCGGCTCCAACTACTTCCAGCTCGACGCGGACCGCAAGCGCAACACGTCGGCCA
ACCGGTCGCACCTGAACGGGGACGGGCGCGGCACGTTCGGCGACCGGCTCAGCATGATGGACGTGCTGCCGCCACGACGCACGGGGGCAACCAGCTGCGC
GGCGGCGGCCTCGAGGGGACTTCGCGGACGAAGTGTCGGTGGACTTCTGCTGCGAGGTGCTGTACAACAAGTTCGGCTTCCAGTCGGGCTCGGTAGACAA
CCAGCGCGAGCACGTGCTGCTGCTACTGGCCAACGCCAAGGCGCGCTCCAAGCCGCAGGACCCGCCGGGCCACCACGTCGTGACGCTGCACAAGAAGCTC
ATGAGCAACTACACCGAGTGGTGCCAGTTCATCGGCGCGGGGAGCGTCACGTACACGGGACAGGCCCAAGGAGACCTCAAGAACCCGCTGCATATGGACA
TTATGCTCTTCCTTCTGCTATGGGGGGAGGCTGCCAATCTGCGGCACATGCCCGAGTCTCTCTGCTACCTGTACCACCAGGCGGTCAATATGCTCAACCA
GGACTTCCTCGGACAGCAAAAAGTACCCGAAGGATGGTACCTCAGACAGGTGGTGCGTCCTATTTGGAAGGAGGCCAGCAACATGCAGCGGAAGAACAGC
TTGGGCAAGAACTTGGAGCATACGCAGGTGCGCAACTACGACGACATCAACGAGTACTTTTGGAAAAAAGTACTGTTTGAATGTGGATATCACCCACATT
GGCGAGGAACTGACCAAGAAGCACACCAAGACGTACTACGAGCACCGTAGTATTTTCACGCTCGTGCTCAACTACTACCGCATTTTCCAGTTCAACATGA
TGTTCATGATGGTGCTCATGGCTATTGGCTTCATCTCGGCCATCTCGCCCAGTGGCGGCCAGCAGTGGTTTGCCCAGTTTGGCTCCATGGGCGAGGTGGT
GGAGCCCTACCAGCAGCAGGACGTCAAGCTCACGTACGTGGGGATTGTGTGCGCGCTCTCCACCATGGGGTTCTGCAAGACCGTCTTAGAGGCGTGTCAC
GGATGGCATTTGCTCACAGCCAGCGAGGCTTCCGCTACGTCGTCACGGTCGTTCAACTACGGAAGTGCACTGGTTGTTCGTATGCTCTGGAACGGAGCGT
TCGCTGGCATCTTCGGTTGATGATTTACACTCCACTCATCACGAGCAAGAACACTGAGCTGTTGGACAAGGCTGCTCCAGCGTCAATTGCCTACATTATG
CCTGGCGCCTTGATCATGACTGTCCAGGCTTTTGCCCCGTCGATGGTCACCAAGACGTTCGCGGCCAAGTTCATCCGTGAAGGTGAGTCGTGCTTCGTGG
GACGCAACATGGCGCCTCCGCTCAGCTACCAGATCAAGTATATCACGTTCTGGGTGATTCTGTGGGGCGCTCAAGGCGTTCGTCTCGTACTTCATCCTGG
TGCGTCCGCTGGTCTTGCCGTCGCTTGCCATCTACGAGATGGATCTCGAGTACGGTAGCAACGTTGTGTCGTTCCACAACTTCGGCGTGATCCTGGCGCT
GTGGATGCCGGTGGTGTTCATCTTCAACTACGATACCCAGATCTACTTCACGATCTTCCAGGCTACTCTCGGTGGTATCCAGGGCCTTATCATGAAGACA
GGTGAAATTCACGGCATCAAGGAGATCACGAAGGCCTTCCGCGTCGCGCCTCAGCTTTTCGACCAGAAGGTGGTGACCAACCTCGCTCGCTCGAACGATG
CTGCCGCCGATGGCTCTGCTGCCGCGTACCAGTCGCAGATGATGCTGCGCTTCGTGGTCGTGTGGAACGAGATCGTGAACTCGTTCCGCGAGGGAGACCT
GGTGGACGATAAGGAAGCTGCCATCCTGCAGTACGACATTCAGAGCTCCGGCGATGTGTTCGAGCCTGTATTCCTGTCTGCTGGAAAACTGGTGGAGGCC
CTCGACTACACAGTCAAGTTGGCTAAGGAGGGCAAGGGTGACTCGCAGCTTCAGGTGTACATGGTGCAGAAGGATTGCCTGTCTGCGGTGCGCAGCTTCT
TCACGGCCAGCATGTACGTGATGGAGGCTTGCTCGGCAGCGACGATGCGGACATCCTCGACGCGCTTCGCCAAATGGAGGCGATTGCTGCCAACGGTAGC
TTCATGAGCACGTTCGATGCCAAGAGCCTTGTGCAACTGCGCACTGTGTCGATGGAGTTCTTGGAGGCCGTGATGGATCTGCCTGACCCGGATGCTCAGT
CCTCGCACTTGACGACATCCAGGGTGCACACATGGGTGTCGTGCGTAACTTCGTGACGAAGATGGAGAACTTGCTCAACGCCATCCGCATTCTAGCCAAC
CGCCCTGAACTTGCTGCCAAGTTCAGCAACTCCAAGTTCTGCTCGAGCGCGAACGGCTACGTGTTTGCTGCCCGTGGTCTGGTGAACCTGTTCCACAACG
ACACGGCCATGGGTGCTGCTACCCGCGCGTACCTGCTGATGTCACTTGAGAAGGCTGATGCGATGCCGCGCGTCCCTGAGGCTCAGCGTCGTCTTGGTTT
CTTCATGAAGTCGCTTCTGATGGACATCCCGCAGCTGACTTCGGTGAAGGAGATGCATTCGTTCTCTGTCGTGACCCCATACTACAGTGAAAGTGTGCTG
ATCTCGCTGTCGGAGCTGAACGATCCGCTAGTGAACCACCCAGTCTTCAAGAAGGTCGAAGAGAAGGGCAAGAACATTACGATTCTCAAGTACCTTATTA
CGATTCACCCGGAGGAGTGGGAGAACTTCTTGGAGCGTATTGATGTGGGCTCGGCTGAAGAAGCGCAGGCAAACTACCCGCTGGAGATTCGTCTCTGGGC
TTCGTACCGTGGTCAGACGCTGGCGCGTACCGTCCAGGGCATGATGCTGTACGAAGATGCCATCAAGATTCTGCACTGGCTGGAGATTGGCTCGAGCCCC
GGCAAGACGGCCGAGCAGAAGCAGGCTCAACTGGAGGACATGGTGCGCCTGAAATTCTCGTACATCTGTGCCTGTCAAGTGTACGGTAAACACCGTGCTG
ACAACAAACCTCAGGCCGATGACATTGACTATCTTCTGAAGACGTACCCGAACCTGCGTGTGGCGTACGTCGACACCATTGCGTCTGACGGAGGCAAGCA
GTTCGACAGTGTGTTGATCAAGAGCGAGGGCAACGAAATTGCTGAGGTGTACCGTTACGAGCTGCCCGGCGATCCGATTCTTGGTGAGGGTAAGCCCGAG
AACCAGAACAATGCACTTCCGTTCACACGTGGCGAGTACCTGCAGACAATTGATATGAACCAGCAGCATTACTTTGAGGAGTGTCTGAAGATGCCGCAGC
TTCTGGTGACCGCTGACCTGCACCCTTCGAAGAAAGCCTGTGTCGATTATTGGTATGCGTGAGCACATTTTCACGGGTAACGCTTCGTCGCTGTCGAATT
CAAGTCGTGGCAGGAGCTGGTGTTCGTGACGCTGTCGCAGCGTGTGCTGGCCGACCCGCTGTACGTCCGTATGCACTACGGTCACCCTGATATTTCGACA
AGATTATCGCCATGCCTCGTGGTGGCGTGTCCAAGGCTAGTAAGGGTATCAACTTGTCCGAGGATGTGTTTGCCGGATTCAATGCCACGCTTCGAGGTGG
TGTGGTGACCCACGTGGAGTTCATGCAGTGTGGCAAGGGTCGTGATGTGGCGCTCTCTCAGATTTCGATGTTCGAGGGTAAGCTGGCTAACGGTGCCGGT
GAAACTGCGCTGGCGCGCGAGGCTCACCGTATGGGCCAGTTCATGGATTTCTTCCGTCTGAACTCGATGTACTACTCGCACACGGGTTTCTACTTCGCAA
CGTGGATGACGATTGTGACGACCTTCGTGTACATGTACTGCAAGTGTACCTGGCTCTGGCTGGTGTGCAGCAGCAGATTGTATACGACATGAACACAACT
TCCGTGATTACCGAGAACATTGCCAACAACTTCGACGAACGTGTGTTCACGGACCTGAAGGCTGTGTTGAACACTCAGTTCTACATCCAAGCCGGTACCT
TCTTGATGCTTCCGCTGATGTGCGTGTACTTCGGTGAAGGTGGTCTGGTCCGTGGTATGACGCGCTTCATCGACATGATATCACGCTCGGCCCTGCGTTC
TTCGTGTTCCAAGTCGGTACGACGATGCACTACTTCGACAACAACATCGTCACGGTGGTGCCAAGTACCAGGCCACGGGTCGTGGTTTCAAGATCTCTCG
TGAAACACTGGTGTTGCTGTACAAGGCGTACGCAAGCTCACATTACCGAAAAGCTTGGGAGCTTATTGGCTTGTGTCTCGTGTACTTGACGTTTGGTAAC
TTCTACATCTGTCAGACGGATGCCTCGGCCAACGACAACACCTTCGCGTCCGACTACTGTGATACTTCCCAGGCTTACGGTGTGCAGACGTTCTCGGTGT
GGTTCATTTCCATTCTGTGGGTTGTCGGTCCTTCCTGTTCAACAGTGATGGTCTTGACTACAGGAAAACGAAGGTGGATATCCAGCAGTGGTGTATGTGG
ATGTTCGCTCCCGAAGACTTCCAGGACGACGATCCGGCAAACAAGGGTGGCTGGGTAGGCTGGTGGAAGGGCGACCTGGAGCAGCTGCACGCCTCGAACA
TGATTTCTCGTGTCACCGTCATCCTCCGAGAGTGCCGGCACTTCCTGCTGATGTTCTACGTGGCTACACTCGAGACGTCTGACGTGATGTATGTCGCCTA
CTCATTCGGTGCTGCCGTTGCGACTGTCGTTCTGCTGGGTGTTTTCCATGGCATCGGTGTGGGCATGCGCTCCATGAGCCCTGTAACTCGCGCGATGATT
TACTTAGGTACTATGACCATCTGGGTCACGGCGTACTTCTTGGCCACTAAGATTGTCTTGGACTGGAGCTTCACGTACGCAATTTCGTTGTTCTTCGCCT
ACGTGGCTGCCTTGTACGGCATCAACGAGTGCTTCCGCATGTGGAGCTTCCCAGGCTCCTCGATCGCCAGCATCCCGATGTTCCAGCAGCTGCAGTTCCT
GTTCGACTTTATCTTCTGCACGGTATGATCATCCCGCTGGTGATCTTGTCCTGCATCCCGTTCTTGAACGTTATTCAGACGCGTATGATGTACAACGAAG
GCTTCTCGAAGGTCATGTCGGCATCGTCGCAGTACGCGTTCTCGCTGGCCGCCTTCATGGGCATTCTGGGTGGTATTGGTGTTGGCTGGCTGTTCAACCT
GCTCTCGACGCTGGAGCAGTCGGCAAGTTTTGCGAGTTATGTGGTGACGTACGACGGCGTGCTCAGTGGCAATGTTGGCGACGGCACGACCACCTTCATG
CTGTACGGCGCCTGCGTTGTCGGCACGATTATTGCTGGCTTCTTGAACTACTTCCTCGGCCGCCGCTTGTCCATCGTTGCCGGTGGTCTGTTCAGCACGC
TCGGTATGGTGGCTGTCAGTGCCAACGACGACCTTCGTTCAACTCTGCTCATGCCTGGCATTGGTCTGCTCGGCGCGTCTTGCGGTATCCTGCTGCCGTC
ACTGGCCATCTACATCTACGAGATCTCGACCAAGGAGATGCGTGGCAAGGCTATCTTGCTGCTGGGCATCGGCTTCATTGCCGGTAGTCTGCTTGGTGGC
ATTTTCGCGACTGTGAACCAGTTGGGATGGATCTGGCAGACGTTCGCTGCCTGCATCGTCATTGCGTTGGTCACTCCGGTGGTGAACGTGTTCCCCGAGA
GTCCGTACTGGGTGCTGGACCGCAAGGGCTGGGACGCGTGCGAGGCCTGCCTGGTCATTCTGCGTCGTAAGCCTGACGTGCACGACGAGCTCAAGATCAT
GCGCGAGGAAGAGACCGCTGACGAAGGTGGCTCGGGGCCGTTCAAGTTCCTGATCGGCCTGTTCCTCATGCTGGTTTCGGCGCTCACGACGGGCTTCTTG
AACGCCTTCATCAGCTACAAGGGTGCCAGCGAGTACACCGACCAGGACCAGTTGTTCGTGAACGGCATGGCGCTGCAGATCTCCGGCGCGGTCATTTCCT
TCTTCTTCATCGACAAGCTGGACCACAAGTCGATCCTGTTCGCAACGCTGATCCCCGTGGCAGGCTGCGCGGGCTTGCTTGGCTTCAACGAGTCGTCGGA
TCTCCTCGGCAACCCGGAGGGCTCGGGCCTGTACGTCAGCCTGGTTGTCATGCTCATGTACTTCTTCATGGGTCTGGGTACGAGCTCGCCCCCTTGGACG
GCGTGCGTCGGCATGTTCACGACGCGAGGTCGCGCCTCGTCGACAACGTTCCTGTTCGCGATGTTCTACTTGCCCAACCTGGGATACGTGTACATGCACA
CGCACGACTCGATGATGGCGAACGAGTACTTGTACCTGTACGCGATCGCCGGTCTCTGCGTCGTTGTACTCGTCCTGCTGCTGGGTGCTGGTACCAAGAA
GAACGGCGTCATCTCGACCAAGGCTGAAGGCGAGCGTGACCGCGAGCGTGCTGCTCGTATGCGGGCCGATCGCGCGACTCGCGCTTCTCGTACGCCAGGT
GCGCGCCAGCGGAACCTCAGCCGCGTGCGGTCCAAATCCAACGCTGGCGGCCAGCGCGGCAACGCGACGCCCGGTGCCGGCTACCAAATGTACGAAACAC
CCGCGCACGCTGCGCCGCCGCTCACGCACGCACGCGCATAAAG