Description :
From Genome Similarity Track
Location :
Scaffold_1:2754423- 2760103
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00718hypothetical protein
Phypa_INRA-310PPTG_00719myosin-like protein

Sequence
5680 bases(100 bases per row)
CTGCCAAAATTAAGGGATAGAAAGTGGCGAATTGTCAGTCCGCCCTATCATTCGTCAGCGAGTATAGACGAGCTGTCATCTGTATTTTCCTATTGAAAGC
CCCCACGTCCTATACTTACTACCTTACAATTTCTAAGTCAAAGTCGCCATCAAAATTACAACACCAAATCTTCGCTCATCATGACACCTTGCCATTCTTG
TTCTATCCCACACGCTGTAAGGCGTCAAGTAAACACTTAAACAGGAAGTATGGCGTCCGCTGATGAGATTCGCGCAGAGAATGAAAGCCTAGCGCGTGAG
ATTCACGCGCTGCTGAACGCCAACACTACTCTGGAGAAGGAGATGCTGAAGCTGAGCTCAGAGCGAAACGAGCTCGAGAACTTGGGCAACAAGAAGCTGC
AGACACTGGAACAGCAGCTCGAGACGGTTGACGAGGAGCTCACGTCGCTTCGGTCGCAGTGTCAGTCAATGACGGAGATCATCGAGAACGCGAATGCTGA
GAACGAGGTTGAAGTCGAGGAGGAGCCGGCACCAGTGCCTGTCAGTCGTAAGCTGTCCTCGGCGTTAAACCACACCATGCAGCGAGCACGAGGCATGTCG
ATGCCGCGCCAGCGGCGATCATCGACAGTGGAGATGGTGGCGCATGGCCTCACCAAGGCCGCGAGTTACATGATTCCTCCCACAGCAAAACCGAGTCCTG
ACGGCCCTAGCCGAGTCAGGATGAGCAAGGATAGCCCACCGATCTTGTCGTACGCCAAGGGCACGACCGATTCAACCAAGAGTCTGCTCTTCTCAACTCA
TTCGCACTACGGCAACTTCCGTCGGCACAGCGGGCCCTATCGCAAGAACCGCGATCCACCTGTCATGGTGCTTTAAGGAAGGCCCTAGCTCGACAGAATC
GAAACCGGATGCAAGTTTGCACCTCCTTCACCGATCTCATTATTTAAGCAACAACATACAGCTGAAAGTCAACTACATCCGTCCAGAGCGCCCAGCGTCA
CACCACACAGATCACCAAGCACCGGACTCCATGCTTTTCCGACGGATAGAAAAGCACAAAGGAGAAGACCGACGGCCCGCGATAAATCTTTCGAGGTGGT
ATACTATGCATGTCCAGTCCCCAGTCTACAATACAAATGCAACCGCGTTTTCCTGTATGTTATCGAATCATTTGGAATACTACGTAGTAATTAGGATACT
TTGATTGGTATGGAGCATGGTTGATATGTTTATTATGGATCGATCTTCAAAGCTTCCTAGCTAGCTGAACAACGAACTACTACTAATGAAGGGGTAACAC
GCAGTTCGAAGCGCCGAGGCGACTACACGCTACGTGCGGTCCCTGAAGGCGTCTCCGTCTACTTACAGTCCGCTAGCCGACTTCTGGCGCGCCAGCTTCT
GTGCCTTGAGAGAGGCCAGCGTGGGGCGTTCGAACTGAGACTTGCCCAGCTTGCGGTTCACGTAGTACACACGACCCGTGGAGCGCGACACCTTGGCCTC
CCAGCCGACAGGAAGAGAGACTTCCGGCAACGCGTCCAGGTTGAACGACTCGCGCACGGGGCGGTCCGCCGGCTTCGCGGCCGGCTTCACCTTGGCGCTC
TTCGAGGTAACGACCGTCGTCGACGCAACGTTGTCGGACGGGTTGGCGTTCTCCTCCGGTTTGCTGTTCGTGCGCTTGCTACGGTTGTCGTACATCCCCT
TGACAACCGACATGCGGCCCTTGAGGCTAGACATGGCACCAGTCACGCCCACTTCCATGCTCTTGACGATCGTGTTGCGCGTGGAGGAACTGTTCGTGGG
GCTGTCCTCACCATCAACCTCCGAGACGTCGAAGCCGTCGCCGTTGTCGCCCTTCTTGCTCGAGTTCCAGAAGCGAGAGCCCACACTCATGCTCGGCATG
CGAGGGAAGTGGCGCTCCGACGGACGCGTCTCGGACGAACGGTTCAAGTCGTCCGAGCCGGTGAGCGAGTCCATGAGCACAGTCTCGCGTGGCTTCTTCT
CCTTCTTGGAGCCCAGCGTGCGGAAGATCGACTTCTTCGGTGTGGGCTTCTTCTCAGGAACAACACCCTCAGCGTGAAGTTTGGCGATCTGCTCCGTCAG
CTTCTTGTTTTCGGCCTCGAGCTGCGAGATCTTCTTGTCCTTGTCACGCACAGTGTCCTGCAGTTGACGGACCTTCACGTGGTTACCAGCCGACGAGAAC
TCCTTGTCACTCTTAAACTTCTCGATCTCGGCCTTCAAGCCCTTCATTGTCACCTTCATGTCCTCGTTCTTCTCACGCAGCTTCTTGTTCTCGTCAGTGA
GAGTCTCGATCATACCGCCAGCATCAGCCATCACAACGCTCGAGGCAGCGGACGAGTCTGCCGTCGCCACACTGCTGCGGCGCTGGAGCTGCGCATTCCG
CTCCTGCTCTTCCTGCAGAGCAGCCTTTAGCTTCTGCAGCTGGTATGCCATGTCGGCCTCGCGACGCTTCTCCTCAAGAGCAGCAAGATACTTCGGTCGC
TGGATCGTCATACGAACCACAGCTTGGACACGGATAACCATCTCGCGCATCAGGACGTAACGGTGACGCTTGACAAAACCACGCACATACCGCTGGATAA
TGACAGCGTTGTGGTTGCTCTTGACTTCAGCAGCCACCTTGCGGCCCTGCATGCCTCGCCAGTGAGCTTGCGCCGAGATAAGGCCCTTGAGAAACGTGTT
GTATCGGCGCATAGCAATCACGCACCGAATCACTGACTGCAACTTGATGATCGCTTCCAGTTGACGGAGGTACTTGATACGCTGGGTGAATCCAACCATG
ATGTTCTGCAGGTATGTGGCCTTGGCATCCAGAAACTTCTTACGGCGATCCTCAAGCTCTTCGAGCACACCTAGCTGGAAGTACACGCGGGTCTTACCCA
TCTGGTACTGAGTGGGGGACTCCAACTTCAGCTTGTCCATAAGCAGTTGGCATTTGTCTGCAACAGTGTCACCACCACTCGGTACGAACAGCCAGAATTT
GTCAAGGATCTCCGTGTGCTGCAACCGGTTCGGGTATGCTGCACGCGAGATACGAATGGCTTCAATCACACCGGCACATCGCAACTGGGACACCACCATG
TTTTGGTCCATGGCAGTCGCGCTCTTGATCGGGTTGGGCTTGATGCAGCGCACGTAGTGAACACGAGTCGAGTTGATAGTAGCCATCAGTTCCGTCAGAC
TCTCTTTGAACTGGGTACCCACAGTCGTGATGGACAGAGCACCACCACGTTTCCGGCGACCTCCAGCTCCCGACGTCTCAGCAACAGCCGCCTTAGGCTC
AGGCTTCGGCTCGAAGAGCTTGGCGATGAACGGCTTGGATGAACCACGCATAAGTTCGGACAGATCAGGCAACAGTGAGTCCTTGTGCTTCTCCAGGAAT
CCCACCGAGTCGTACATGACAGGAGCGGCGTAGTGCTTGATGAGGAACTCAGTACGCGACGTACGAGGGAACTCAATAACGTGCGCCATATCATCCTTAT
GCAAGGACGTCACCTTGGACATGAACGACTCCTCATTACCCTTCGGTCGCATCACCTCTTCGTTCAGCAGTGAAATGATACCCATGCGCGACTCGATCAC
AGTCAGCACGTCCTGGTTATCTGCGTACTCAATGTGGTCCCACACGATTCCTTCCTCCTCGTACTCAATTTGCACGGTCTTGAACACATCCTGAGTGAAC
TTTTGCTGAAGCTTTTCGTTGGCGTAGTTGATGCAGAACTGCTCGAACGAGTTGTGCTTGAAGTGCTCGAAACCGAAGATATCGAGCACACCCACGTGGT
TGGCCATGTTGGCATCGTCAGCAAGCGACTGGTTAATAGTAGTCACAAGCCAGTCGAACACGTTGGAGTAGATAGCCTTAGCAAGAGCGTCGCGACAGTC
CATGGCCAGCTCCTTCTTGAGCGGTACACTGTACACATCGTTCACAGCACGCATGGTACGCGAACACAGAGCGGTCTGAAGGGCCTCCCACGTGACGCCC
AGCATCTGCGTGGCGGAATTCGCACCACTGTCGCCCTCGGTGATGAGAGACTTCTCGTCATCTGTCGGGTCCGACTGCAACTGCACCTCACCGAGGTGGA
GCACACCAGCCAGCACTTCAAACAGTGGCCGCTGGTCGTCGCGAGACAAACCCACAAGCTCCAGCGCCTCACGTGTTTTGTTGAAGTGTTTCTCGTCAGA
AAGTCCTTCAATCTTCTGTGCCGTGTTGTCGCCCGTGTACACATAGTGCTTTGACGAGTCGAGCTGCAACTCCGACGCAATGTCGGAGGAGTCAAGCAAC
TGGTAGAAGATGTGGTAGTTACGCTCAGGCGCTTCGTGCTGAATGACACGCGTCTTCTCCAGAAGATACGTGCGGCACTTGGCTCCGACAAGCGTGCCGT
TCTTGTCGAACTGCAGCTGTGTGAACTTGCCAAATCGACTGGAGTTGTCATTACGCACAGTCTTGGCGTTACCGAAGGACTCAAGCAGTGGGTTTACTTC
GATAATCCTCTTGATAGTGGAGTTGTTGAGACCACCGGCGATAGTGGCTAAGTGGTTCATAAGGATCTTGGTGGTCTCCGTTTTACCGGCACCGGACTCA
CCACTGACCAGAATGGACTGGTTACGCTCTGAGCGTCGCATGTTGTCGTAGGCAGCGACGGATGTGGCATACACGTGCGGGGGCAACTCCTCCTTGGGCT
GGTTGAGGTACCTCAAGTGCTGCTCTTCGGCGTACAGGTCTGGGAGCCACTTGTAGGGGTTGACAGCGATACAAATGTCGCCTGTGTACGTGTAGGGCAG
CTCGCAGAGGAAGCGCTTCTTGATATTGAACAGGATAGCTGCCTCGTGCAAGTAGTTGAGAGTGATCATGTCCTCGATGCCCTCGGGCCCAACGTTCTCG
TTCTGGTAAGGAAGCGACTCGAGCTGGTGCACATCTAGCAGCGCCTTTGTCTTCTTGGACAGCATGTCTACGCAGCGCTCCTCGGTCTCGCCGTCGGGCA
GCTCAACTTTGCAGTAGATCTTACGTGTCTTGCCATCGCCCGAATTCTCGTCACGCAGTACCTCGGCCGCGAGCCAAACATGAGTCTCATCCGGCACGAA
GCACTTGGCGCCCACCACCATCTGCAGGTCACTCATGGTGTCTTCAAATCCCCCTCGGCCCCTCTAAGAACTCAGGAAGCTGGCGCGGCGGACGGCCTAA
AGCGGAATGGGTCGAGTTGAGCCGAAGGGGGAGCTGGCAAGATACCGCACATAACCGGTAAGTGGAGCCATCTTGCAACTGGCAACTACTTTCACTTGAA
GTTTGTATCTTAACTCTGATCCGACAACATCGTTTGACGACATAGCCTGGCCAGTGCAGCTGGACACCGCACGTGGCAACCGGCTGGGACGGACGGCGCG
CAAAAGGATTTGATCATCGGTGCTGGCACACCAACGTGCGGCGCAGTAACCATGGCCGTGTGCCTCTTTAGGGGCCATAAATGAAGTGCGTGCCTTCATG
TGGCAAAAAGTATCTCACCCACGAGCTTCATAACGTTACAGAATGAAGCATAACGCTGGAGAAGAACTTCTTCAACACCACCTCATTTTGCATCGTTTCT
GCATTGGAAATGATTTACCGTCATAACAGCGGTTTTCTTAACCTGGCATCAAACTTGAGAAAACCCCATTATTTCATACC