Description :
From Genome Similarity Track
Location :
contig_265:2754- 3798
Transcript NameFunction/comments
g12259.t1hypothetical protein PHYSODRAFT_344027

Sequence
1044 bases(100 bases per row)
GTCACTCCTCGCTAAACTCGGTCCACTCCATATCGAGGACTGCGTAGAGAGCAGCTTCCAGCTCGGCCTTGTTGTCGTATAACGGCAGTTCCACACGGTT
GAAGCACGTGTGCACCTTGGGGAAGCCGCGAGTTTGCCCAGGCAACGGCCGCAACGAGAAGGGGCAAATGCGGCCGTCATAACTGGTTAACCCCTTGAAG
CCCTGCACTGGCACGCGCGATGAGCCCGTGGAGAACTGCAGGAATCGTGCACGTTCGTCCTCCGTGAACGCCTGAAGTACTTCCCAGAACCAGCCAACGA
CGTACGGGGCCTCGTCGAAACTGGGAGCGACCACGTGTTGCGCTTCCAGTCGGCGAGGTCGATCTCGGGAAGTCCGCACAGCACGAGCTCAAGCTCCTGG
TAGTCGAAGACCAGCAGCGCTTCCTGTGGGACGACCTCAAACAATCCAAGAGACAGAGCTTGCAACTGCGGCCCGTAGCGATCGAGCATGAGGTAGCGCA
GCTTGAGGTGCAGGAACTCTTGTTTGTTGGCGTCCGTCACGGGCTTGTCCCGTCCATCAGACACCAAGTCCACAGTCACGACTTCGTCATCCGCTCGTAG
CTCCGTGACGGAGAACGTGAGCTCCAGGGCGTCCACGCCGTCATTGTCTCGGATCCAGATCATGCTCGTGTACACCTCCGGGTCCACGTACTGCAGGTCC
GAGAAAGTGATTGGCGTGCCTAGGAAGTGCTTGAGAATGGGCAGACACAGCCGCGCCTGCATGGTCTGTCCTTCCAGCAGGGCGCGGCCTAGCAGTCTGC
CAATGCCCCGGAAGTAGAGCAAGTGGTCGGCCGTGCAGTCTTCAGAGTGCGGGTTAATAGCCACGGCCTGCGTGTGTCGGTGGCACGACATAAAGAGCCC
CAGCTCATCGTCCAGCAACCTGCCGAACAAGATGGAGAACCATTCTCGCTGCAGACCTCCGGCGTCGATACCTGCTTCCCCGACGAACTCGATGCGAAGC
GGGAAGTGAATGTGCTCGGGCTGAATGCCCAGCAACTGCTCCAT