Description :
From Genome Similarity Track
Location :
Scaffold_236:2754- 3765
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_236-snap-gene-0.11CENP-B protein; Homeodomain

Sequence
1011 bases(100 bases per row)
AGCGACTGAAAGTGACCTCCCACCGTCTCGAGACTCAGCTGGCCAGGTGGATCAAGCAACATGAGCGCAAGATCTGTTTGTCAAGGGCATTGATAACGAC
GCAAGCTCGCAGACTACAGGCCAGGCTGTTGGGTGATGCGATGAATTTGTCCTTTTCCGATGGGTGGCTGTCCAAGTTTATGAAGCGCCATGGCTTGCGC
TTCCGCAAGCGTCACGGCGAAGCTGGGTCCGTCGATCCAGCCGTGGTGGAGGCTGGCCGACNNNNNNNNNNNNNNNTGATATCCAAGAAGTCACTGATCT
GTACGACGATGAAAACATTGTCAACATGGATGAAACCGGATTATGCATCTCGATGGCACCAACAGGTTCAATCACCAGCGAGTGCATACCTGGAGATAAG
AAGGACAAGACGCGCATCACTCTGGCCGTGACAGCAAATGCCGACGGCTCGATCTTGATACCGCTATTGTTCATCGGTAGAGCTCGCAAGCCCCGATGCT
TTGGGAAAAAGACACCGCAAGAAGCAGGGTTTCACTACGCATTCAACAAGAAGGCATGGATGACAGGTAAGTGCTGTGTTTAGAAACAGAGCGTGCGATG
TGCTTACCTCAATGGCTTGCGCGAACAGGGGCGTTGTTCCGGAGCTGGATATTGGAACTGGATCGCGACATGCGCGCGTCCAGCCGCAATATCCTTCTGC
TTCTTGACAATGCGCCATCACATGTGCTGGGCGATATCGTTTTGACCAACATCAAGATCAAAATGCTACCTCCAAACACGACGGCCAGGATGCAACCAAT
GGATGCCGGCATCATTGCCTCGATGAAAGCTGCCTACAGATCAAGGCAAATGGAACATGCGCTGAATCTCATGGAATCGGGAGAATATGAGAAGCTCAAC
GGCAAGTCAGTTTACCGTGTTGACCAGCTTCAGGCCATGACCTGGTGCGACGAAATTTGGAGTGCCATGCGTCGACAGATCATCGCAAACTGCTTTCGGC
ACACGCGTATT