Description :
From Genome Similarity Track
Location :
Scaffold_72:275344- 281332
Sequence
5988 bases(100 bases per row)
CTGCTATCGCCGCGGAGCTCACCCGTCTAAGGGAGCAGGTTGTAAACTGGATCGGGATCTCTAACAGGCTTCTCAACAAGCACGTCAAGCGGCCTCTCAG
CGTGATCACGCGAAGGAAGAGCACCAGAAAATCCGTAAGTGTGGTATCCTCTCGCTGTCTCGATTTTACTAATAGCTTTGTCGCAGTGGGTCACGTATCT
GCAGCTCGGTGAACAACCGATCGCCTGGAGAAACGACTTAGTCGAGTGGAGACTTCGGAGAAGCTTGCTCGCGACCTTGAAGCCACCCACGCGACCTTAC
GAGAAGAGATAGACAAGATGGTGGTCGGCCGAAACACCCTGCTTTACAAGCTTGACGAGCGGCTTGTGGAAGTTGCCAGCATGAGAGAAGATCGGGACCA
AGCGTGCGAACGCCAAGCAGGCATCGCATCCTTGCTTCCTTCCGGGTCTGCTTCCTCGCCATCATACCCATCTCCTCAAATCCGCAAACGCCCTCAGTCT
TCGGGATCTCCGGCTAGAGCTACTCGGTCGTGCAAAGTTGCGCGATCCCCGTTTCACTTGTCTTCTCCGGGGTTCACGTCGTAACGCCAACAATTGGCGT
ATCCGATCGATATGCTGTCTACTACTGCTGCAACCTAATCTGCCACTTCCGCGTCTTCTGCTTCCTCGGATAGCGGCGGAGATAATTCCGACAACTTCTT
CGCGGTCCCGAGCTGCTCGTCGGTCGTCTCACGACAGATCTGATTCTCCGCAACTCGCCCGATCGGTTCGATCTTTAGGTCAATCCGTGGGTAGCGGTCA
TTCCTACAGTATTTTGGCTCACCTTGCTGCCGCTGGGTTGGGTTCCAGCAGCGACAGCAGCAGTCCCCGCGGCTCAGATCTCAGTTCTGGCACAGATTAT
GGAAGTGATGCATCCTCAAAGTCTCCCGATCGTGGTCGGGGTTTTGATGGCTTGCCCAATGTCTTGCTTTCGGACACGAAGTTGGATCCCCCGCTGGCCA
CTCGTGTACCTCAGACCGACTGGATCCCTGGTTATCGCGATCACCGCCTCTGCCAGGGTCATGTGATCGCCCCCTGGTCCTCGCTAGACGTACACCAGAC
GTGTATCTCGGAGATGGGCATGGACATCTTGTTCAGCCAATTTTCCAAACCTCTGAAGCGGTTGTTCCCACTTCGTAGACCGACGCCCCAGCTCCAGGGG
TGGAGAGACGATCTGGTTGACGCGGATGGCGTGGTCGCCCTGATTGAGCCGTTTCCATGGGCGGTGCTCGTGACCGGAGACAGTCCACTCACGTTTGGTG
AGGACGTGTGGTTTGTGCATATAGCACGTCTCTACTCAACCTACGATCGGACTTCCTCAGAACTTACTGGGACTCTACTCATGCCTTCCCGGTCAGCATC
GCCAAGCGTCGCGCTAGTCGGTACTTGGACGCCTTCTATACCGTCCGTAAACAGCGGCGATCCCGAGCGGTGGCCCGGTGGAAATCCTTTCTTTGATAGA
TACTGCTTGGTATAATTCGTGGCTTTTGTTACCTCGATCTACTTTCCTTATTTCCTCCATTTTCCTTCCCAAGCTGAGGCAGCAGCTTGGAATCCCGGAT
TAGAAGCCGTAGCTAACCCGGGCAATCTTCTTTAAGCCTTGTCTGTCGCAGACGAGGCTGATCGCTGGTGTAATCACTACTGTGACGTAGCAGCCGCCAC
CCCGCACTTAAGATCGCGCGTCTACCCGGAACGTTCATGCCGACCCCCCATAGTCGCGTCACCTTTCCAGCGTCAACCTGTAGTTGTGTTAGTTCCCGCG
CTGGTGGAGCAGGCCCAGTCCATCTAACCAGTATGTGTCCCACTTTGTCTCTCCAGATATCTAGAGAGTTTATTTGGCTCTCTTCATTTTCGTTTGGCCC
AATTCAACTCCCCGTCGGACCTTCTCCGATTGGTTGCTCCTCGTTTGTAGGCCCACTACACGGTAGGAATAATACCTCCTTCTCGAAACTAGCAGCCACC
CTGCAAGTCCTTCTTCCTTTCGCTTCTCCGCCTTGGCGAGCCCACCGCAGATGTTCCACCGCATACGCCTCGTGTGACTGCATCATCTCGAAACGATTGC
GACCAGTCCGTCCACGTTCGAAATCGATTAGCAGCGCTCCTCATTTTAGGTCTGCTTCATAGATCTATGAGGGTTCCTCGTAACCCGTCCAGTATACCAG
ATATCCACGTAAGGTGCGGCCGTAGCATGTCAGCCGTCCTGTTCGCCCATCCGCGATCCGCTCGACTTCGACCTCGCCTTCGTCCAGCTCGCGCTCCCAG
CTGTCCTCCGACAGCAGGCTCTCGTCAAAGTATACGCAGTCGGTCCTTTCGTCCGTCGGCGAGGCGGTCGGTCCGGATACGTCTTGACTAGCTTCAGCCT
CGTCACATGTACGATCGGTAATAGTCGACATTCAGTGCCGGCGGTCTCTATTCTTGCCGCATGTCGATCCCCCATTTCTGCCACTCTGGAAAGGCCGCGC
CACATGTGCGCTAACTTCCTAGCGTAACCTTATTTGACACGATCTAGGTATAACCACACCTTACCACCGGTCTTGATGTCATCGGGACGCACACTCTCGT
TGTGTCGATCTGCTCTCGCTGTAATTGCTTCGCGCAGAGCTTCGTTGACCTGATCTCGGGGCTGTTGTGTACTGTCGCTGAAAGTTATAGCGCCATCGAC
GCGGCTCCGAGTCCTGATGTCGTGTGCAGCTGAGCGAAAGTGTTGCTTCCAGGGTCCACCTTGCGTCCCATCCGTGGATCAGGTAAAACGGCGCCTCTCC
GCGAATTCGGTCATGTGCCGTGTTAATAAGCGAATGTCAAACGCTCTGCGTACTCGTCCCAGTCCTTCTTATCTATATCTGCGACGTACCTATTTAAACG
ATCTGGTCAGCGTCTGCACCATCCGTTCCGCCGCCCCGTTGACCTGAGGCCGATACGCCATAGTGGCACGCTGCGTTTGTCCTACGATGCTATTGAATGC
GCGAAAGGGAATCAGACATGAAACCTGGCTCCCGATCGGGCCGGATAACTTCGGTCGCGCCGAAATGGCGGAAGCCACATTCTTCGTTGTTCTCGGCTAT
CGTCTGCGCAGTTTTCGACGCGCTTGCCTGGGCTATCACCTAACCTGAGAACCGATCAACCCAGATGAGCAGCTCGGTATTGCCCTTGTGCGACTTCGCC
AGAGACGGGATATGGTCCATCGCAACACAGTGGAATGGGTACGCTGCTTGTATGTTCCCCGGCGATTCTGATCGAAGTGTCGGGTGTCCTTTTCCTGTCT
CGCAATCCACGCATTGTCCCACGTAGCGCTGCACACTCTTGAACAGGCCGCGACAATGGAAGCGCGAACTCACTCGCTGGCACGTTCTTCCTATTCCTTG
GTGGCCGCCTTCCAGACTTGTGTTGTAATGATGGAGCACGTCTTGCTGTAGATCTTCCGTTAGTACCAGTTTCGCCACTCGATCGCGGTCAACGTCGTCT
CCCCTTGCAAAAGAAGAGTAGCCCGCCCTCGCCGGCTTCGAGCTCCTCGGCGATTTTGCTACCAGTACGCGCCTCTCCAGCGCTTAGCTTCTCCAGATCA
CCCAACAGGTAAACTTTTAGGTCCGCGATCCACTTCTCCTCGTACTGTGCTTTCCGGATTCGATCCGTTCTCATACGTTGTACGATGTCCAACTGTAGCA
CTTCCGGAGGACTCGCGCGGCACGTCCGTAGTCGTGTGACAGCCGCTACGCGTATCCTCGACGCCTCGTCCTTCGGGAGCAGCAGTTCCGGCAGTCGATT
GAGAATGCTCAGGTCCTCTCGGTCTGCCTCCGAGGTAATTACGGCATCTTCTTGTGTACGTAACCATTGCTTGCTAGCCGATCTGCGCTTTGATTCCATT
CTCGCTTGACATAGAGCAATTCGTATGACGGCCATGGCCTCAGTCGATCTAGCAGCCGCTGTCGCAGAGGCGTCAAGCCGGGTGCCTTGCACTCGAGATC
ACCGCGCATCTGCCGGATCACTAGGTTGGCGTCGCCGCAAATGATCAGCCGCCCCCTGTCTAGGTTGGACAGTAAATCGAGCGCCAGCAGTAACCCGTGG
AGCTCTGCCACGTTTACCGTGAGGTTCGGTGCGTACTTCGCCTCTGCTTCGACCATAATCCACTCAGGTAGCTTCCTACGATGGCGCTGCACGCCCCCCC
CTCGCGCCGCGTTTAACACGCACCGACCAGACGAAACGCACGGCTTACAACTCCTCGCCTTGGTCAACCGTAGGTGGGGTTGCGGCGACATGTGGTCGTG
GCTGCTTCCTTGGAGCAATCGACGACAAGATCGGGTCGACTTTTTCCCGAGGGGTGATACTTGCTGCAATGGTGCCTAGAATGGCGTTCTCTCCGCACGT
ACACTTGATAGTCTCTAGCGTCCACAGCGAAAGCAATGCTGCCCAGTTGCCCACCGTCCCTGCAAGCCCCATGATCGCACTAGCCATGTCAGCGTGGATT
ATCGCATCAGCACCGTGATCGATCTCGTGATCAGCGTGGTGTAACGCACGTTCAGTATACCGAGAAGAGCCAAGATCTCTTTCTCAACGGTGCCGTAGTT
CAGCTCATTGCACTTCAACGTGCGACTGGTGAACGTTATAGATATGTACATGCCGTCGTGCTCCTGCATCAAGGCCGCCGAGATCTCCAAGTCACTCCTG
TAGACGACGATCACTGGCGTCCGATTGGGGTCAAAGTGTCTGAGCACTGGGGCGTCTGCGATCCTGTTTTTCAGCAGTTCAAACTCCACTCGCGCTCAAT
CCCATATGTTTGTTTCATCCGATGACGCGATCTGCGTCTCGTTCCCAGTAACAACGACTGTTTTGCTGTGCATCACGTGGTTGTCGACTTCTCGTAGCTC
GTACAAGATTGCTGCATAGATCGCAAAGTCCTCGATGAAGCGACTGTAGTAGTTGAGGCTACCCACGAAGGCTTGCATCGCTCGCAGCGAACGAGGAAAA
GACGCTTATCTATCTGGATTAGCTCGGGTGTTATCTGGTACACCGTCAATCATCTCGGCTTCGCCAGCTTTCGCGATGTGTTCGGGTGTTGAATGAGTTG
GCGTTCCTAGGATTACATTGCTGACGTCTTGTGTCTCCACTGCGGCGACCTTCTCAACCTGGAGGATCATAGTAGGCTCACCAACAGGCCGTCGCATGAT
CTATTTTGATGGATCGTACTCCGGTCGCCAGCTGCATCCGTTCAATACCGTCGGTACTTTCCGAATATGCGCTTGAAGCCGCGGAGGCATAGCGTGATTG
TTGGGACGATCCGGTTCGTGACCCAGACTTAGGGGGTCGTGACAGGCTGGCAGCGGGCTTGGACTCTGTCATGATCTGCGTCTGCGACTCGCCAACCAGC
ACTCTCAGCTTCTTGAAGAGCTCCGACTGTGTGTTCTGGATCGTTTCGAGATCCGGATCAAACAAATCCTTCACCGCAAAGGGGCCTGGCGTGACGCCGG
CTTCCTTCAGGAGATACAGTATGACTTTCACAGCCTCCAACTTGTTCGTCGTCTCAGGTGGCAATGGCACCGGTCCCTTCAGCAATCCAAATATCTGGGG
CTGTACGATCCGCATCATTGGGTTCTTGGCTATAACCATTTGAAGCTCATGCTGGTTGTATTCTTCTTCCAACCGATCGTCAGACCAAGTCGCTGTGATC
TCGCCGCGGCTATCAGCGTTCAAAATCAGCTGGGTACTTGAACTTATTCCGCGACGCGTACGAAGCCTTTTTCTTCGGCGTCTTCTACGTTGGCGGAGCG
GTGGTTGATGAGGTTCCTTCGGTTTTCTCCTTGGGGTTTTCATCGGGAAGATCACGTCGCATCGCGATCTGCGGTGCCTCCCGAGGAGACATGGGGGTGT
AGGTTTCACTTTAAGAAGAGATTCCTCTTCGTTTCTGTCGGCAGATCTCCTCCTAGGGCTCTGTTGATCTGCTGATCCTGCTGCATTC