Description :
From Genome Similarity Track
Location :
Scaffold_118:275255- 276863
Sequence
1608 bases(100 bases per row)
TATTAGTCTATACCCACACTCAAGAGGTAAATTAATAAGAAGTGCCGGTACATCAGCGCAATTAATTCAAAAAATTAATAATAAATATGCAAGAATTCGT
TTAAATTCTGGCGAATTAAAATTAATTTTATTAACGCTGGTACAGCGTCGCACCGTAGATCGCGAAGTCTGAATGAAGCGGCTGTAGTAATTAACCGCTC
CAAGAAACGACTGCATGCCCTTCCTACTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTCCGGATCAGCCCTTATACCTTCTGGCGAAAATTT
ATGCGACAGAAAGGCCACCTTGAATTGGCAGAAGATGCTCTTGGTGAAGCAAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCTAGCGTC
GCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAATGATCGTCGACCAGACAGAGGTACCAGCGATGATTCGTCTGGTTCCCCGT
TCGTAAACATGTCAGCGACGGCGCTGTTGACGAGTTGTAGTACAGGGTCGGCCTTCACGGTGCTTCGCGGTCTGCCGCGAGCTTCGTTTGAAACGAACCC
TCGTGCTTGGCCCACGACGTTCCTAGGTTGCTCTTCAGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTCCTTTAGCTGAACGAACCCTCCAGAGA
GCGTTGTCAATCATACGCTGGTAGATCATCCGGGGCGTTTTTTTAATCCAAAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN