Description :
From Genome Similarity Track
Location :
Scaffold_235:27521- 35160
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_235-abinit-gene-0.5660S ribosomal protein L13
Pytve_DAOMBR484maker-pve_contig_235-fgenesh-gene-0.11Folate-Biopterin Transporter (FBT) family
Pytve_DAOMBR484maker-pve_contig_235-fgenesh-gene-0.4CDS Pa_4_9260
Pytve_DAOMBR484maker-pve_contig_235-fgenesh-gene-0.12Formin-homology 2 domain-containing protein

Sequence
7639 bases(100 bases per row)
CGATTTGATTGGCTGACACTTTCGACATAGTGAGCGCAAGTCAAACGGGAGGACTGGTGGTGGGAACCACCAATTCGCGTGGAGCGCGGTGACCGGGCCG
ATTCTTGCCGGCCAAGTTCCAAATTGCCCGCAGCTTTCGGAGTAACTTCCTCGAAGGTAAATGGAGCCGCCGGCCGTGAGGGTCCTCCTGGGCCGCTCGA
CGGCGTCGCGCGCGGATGAGGGGGAGAGAATGAGGCGCTAACTGTTGCTCGCGATGTGGTGTGCCCGTGTGCAGTTCGTCGAAAATGGTGAAGCACAACA
ACGTCATCCCCAACGGCCACTTCCACAAGGACTGGCAGCGCCGCATCAAGACCTGGTTCGACCAGGTAAGCTTGCTCTCCACTGGCGCCAACGTGGGGCG
GTCGCAGACAGCGTGGGCAGACATCATCCGCTCCCTCTTCCTCTACGACGAGAGCGATTGAGCCGCTTTCGGGGACAGCGATCGAATCTCGGCGACTGTC
GATCTGGGCACGAGCTGGACTCGCAGGGAACCGGCAACAGTGGCAGCCGCGAACGCCGGGGACGGGAATGGAGCGGATGATGACGCCCACGCTGTCGCGC
ACCTCTAGGGGGTCGCCATCCTGATCGGGATGGGAGCTCAATGACTGACTGAGTTGCGTCGTCTCTTCCGTCAAACAGGCTGCCAAGAAGAAGACCCGTC
GTCTGCGGCGCAAGGCTAAGGCTGCCGCCATCGCCCCGCGCCCGGCCGCTGGTCTGCTGCGTCCTGCCGTCCACTGCCCCACCGTCAAGTACGCCTCGAA
GGTGCGCGCGGGCAAGGGCTTCACGCTCGAGGAGCTGAAGGAGGCCGGCATCAGCCGCAAGCAGGCGCTGTCGATCGGCATCGCCGTTGACTTCCGCCGC
ACCAACAAGTCGGTGGAGTCGCTCCAGGCGAACGTGCACCGCCTCAAGGCGTACAAGGCTAAGCTCGTGGTGTTCCCGCGCAAGAGCGTCAACAAGCCGA
AGAACGGTGACTCGACGCCGGAGGAGACGAAGAACGCCGTGCAGCACACGGGCCCGATCTTCCCGATCACCCGCACGAGCGTCAAGTCGACGACCGCCGT
CATCACGGAGGAGATGAAGGAGACGAGCGTGTACGCCAAGCTGCGTGTGGCTCGCGCTGACGCCCGCATTGCCGGCAAGCAGGCCAAGCGTCTTGCCGAC
AAGAAGGCCGAGAAGTAAATCTCTGCTCGCGGGTGAGCGAAGGAGAGGCGCTTTCGTGACAGCACGCCATTGAGGTCACTGTGGAACGTTGGAACAATAC
ACACTCACACAAAAAAGGAGGTTGTTGGCGAGGCGTTGTGTGCGTTTAGACAGGAGCCGCTAGTGGCTCGGCGACGTTTGCAGATCGCCAACTCGTTTAG
TTGACGCGATGCGAGCGCCATCTGCGGCGAACTCGGCCGGCCATCTTGCATATTGCCATCTCTCTTAGTCGGCAAGTTCGTCCTGGATGGAGATGGCTAG
TGCACTAGTTAGATGACTCAAAGACGAAGGATGTTGCTTCAATCAGCAGCATCGTCCTATATTCAAGCAAAATCTCAACATTCTCCAGACTTTTCACTCT
CTATCTCATCCAGACGATGCAATTTACACGCGCGCATCGTCCGAGTCCCGGCTGTCAACACCGTCAGGGTGGGCGAGCAGCGGAAGCTTCTCCGTCCCTC
CAGATGCATCAGAAGTTGGCGAGCGGGTGAGGCCATCTGTGCGCACCTTGTCAGGAAGCACATACAGGAACGCCAATACCAGCAGCTGGCCGCCCGATGC
GATTAGAACGAGAATCCAGAGGTGACTCCAGTCGATGATCTTGGAGACTGGATCCGGGACGATGCCGAGCAACGAGACCACAGCTGATGTCAGCAGCCCC
GAAATGACGCCGCCAAAGTCCATGAACGACAGGTACAGCGCGTACGTGAGCCCCTGCACCTCCTTATTGTCCGGACAGTAGTATGTGGCCACCACCAACA
GCTGCAGCAGCGCGAATTCAGCCGTGAAAGCCGTCAGGAACGACTCGGTGGTCACAAACGTGCAGATCGACACGGGGAGATCGACAACCGGTTGCGCCAA
TAGCAGGCGTGGGAGGCCGGCGATGACCGAGCTGACCGTCGACAACAGGAACACGTGACGCACGTTGCGGTTGGAGCACCAGCGCGCGTACACGAGACAC
GAGATGAACCGTCCAACCATGTCAGCGAGCGACATGTACTGCAGGCATTCGCGTTGGTCTTCTAGCAGCGAGTAGGTATACTGGTACCAGATCGAGCCGT
CACCCGGAAGCGCACTGCACAGAAAGAAGAACAGCATCGGAGGCAGAACAGGCAACATGATCTCGATCTTGCGCAGTACATCGGCCTTGAAGCTGATCCA
GCCAACCCAGAACGAGTCGCGCCAAGTCGCAGTCCCAGTGCTGGCCGAGGAGAACTCACTCACTCCGCTGCCTATCGTCCCGGATTCGCCAACAGACATG
TGCCGATGGTTTTCGCGGATGACGGGCAACTCCTTCAACCCAAACGCGCACACGAGCGCACCAAGCAACGGGAAGACGCTGGTCCAGCTGATGACTTGCT
GTGGTCCAATGCTCTTGTTTTTGTAGACAGGAACGCCGATCAGCAGAGCAGCGACCGACGCGGCGTTCTTGGTCGCGTTCGCCAGCGACTGCACGAGGGC
ACTGCTCTTGCTGGTGGCGTCGCCAGTCGTCAGGTCCACCAGCAGGATGCCAAGCATGATCTGCGAGAATGCCTCACTCACGGCGTCAAACAGCTTCACG
ACGAACGCGCCGGTGATTGAGCGCACGTACGTGCCGGTCACGACGAACGACATCGCTGTGCACAGCTCGCAGAGGATGATGTACGACTTGCGGTGATAGC
CCCATATGGGGAAATTGTCCGAAATGAGTCCGTAGAGCGGCTTGAGGTTCCACGGGAAGAAGGTGACCGAGTAGTAAATGGCGGTCGTGGCCGGCGGCAT
GCCCACGATATCGAACAGCCACTGACGGTACGCCGTCATGGGGAACGTCATGAAGAACGCGTGCAGGAAGAAGAGCGCCAGCAGTCCCGGGGGCACGGCT
GCCGCCACGGCGAGCGCGCGGCCGGATCCGCCCATCTCGCCGTCCGCCAAGCACTTCTTGCGCTCTCTGACCTGTTAAACCCACCTGATTCTGTATTGTA
TTTTATTCTGTCCGGTACGATACGAGATGCTGAAGGGCTAGTGATTGGCTAAAATAGTCGACATCACCACTGGGTGTCGATTGCTGGCATTTTGACCGGC
GAATACTCGATCGAGCAGTGGTGGCGCAGATCGCTCTAGCAGCACGAGCGATGGCGCGCGACCAGTTCAACATCGACGACGCCGAGGACTTTGACGACGG
CACGCGAGCCGTGTCGTACGCACCGAGCGACGATGCGCGCGACCACAGTGACGATGAGAACGCGCAGCTGACGTCCACGCGCAAGCAGCGGCTGAGTGGC
GCTCGTCGAGGCGGAAATCGCGCCAAGCAGGAGCGCGCGTCGACGCTGCGTGTGCAGAACTGGGACGCGGGTCAGCTGGAGAGCGCCGAGTACGCCGGCA
AGGTGGTCAAGCGCCGCGAGCTGAGCGACGCCACTGGCGCGGACGAAGACGACTCTCCTGATGAAGACGCGATGGCCGACTGGTCGGACGCCGAGCCGTT
CGGTGCATCGGATGACGAGTCCGAGGAGGAAAAGTCGGAATCTGCTGAGAATGAGGACGCGGAAGCCGAGGAGGAGGACAGCGATGGCGATGAGGATGAG
GACGCCGAGCAGCTCCTCCGCGGGTTCGAGAAGGAGGACGCGGCCCAGCTCATGAGCAAGAAGGACAGCGAGAAGCTCGTGGAGAAGGCGACGCACGTGC
GACACCAGAAATTGGTGTGGGAGCGCTGCCTCGAGGTGCAGATCTACACGAAGCGCTTGCTGACGACCGTCAAGGACGCAGCCGCGCTGACCGACAATGG
AGAGGAGCAGGCGGACACGACCAGGCAGCAAGTCATCGAGCAGCTCTATGCTGCGATCGACACGGTGTCGGGACTGCAAACCCGGCTGTGCAACACTCCT
GAGCTGTCGCCACCGAAGGCGGGGGACGCTGCCAAGAAGCGCAAGCGCGAGTGCGACGTCATGTGGACGGACCTGACCGCCACGAGTGCGGCGATGTTGC
CGCAATACAACGAGATTCTGAACGCTTTTTCGCGCAAGACGGATCTCGCTGCTGGTAGCAAGACTGCCAGCCAGGCCAAGAAGTTTCGCGCGGTGAACCA
GGATATCCTGGCTCAGGTCGAGTCGGTGCTGGTGGACCCTCAGCGAGTGAAGCGGAAGGCCCATGCGCCGTTGGATCACACAGAGGCCAGCGGCAACACG
AGCAACGAGGACGAGCCGGCCGAGGACGCGCTGGACGAGCTCATGTACGACGACTCGGACTTCTACCAGCAACTGCTGAAGGAGTTCATTGAGAGCGGCG
GCGGCGCTCACGACGTGCCACTGCAGCGAACGCACCGCAAGAAGAGGAAGGTGGTGAACCGGAAAGCGAGCAAGGGCCGCCAGCTGCGATTCAATGTGCA
CCCGAAGCTCGAGAACTTTATGTTTCCCGAGCCATACCCGAAGCCAGAGATGGACGTCGACGAGCTGTTCCGGTCTCTGTTTGGACAGAGACGCCAAGGA
TAGATAACCCATTGGATTTTGCATATTAGGATGAAATATACGTCATCAAAAGCGCCGACGTACTGTTGTGTAGCCCTCTCCTTCTTAAATGTGGTTTGCT
TAAAGGACGTCGTCTTCCTCCTCCTCCTCTTGCTGTCCCGTGACGTATGCCTCCTTGAGTTTGCTAGCTTCTGCATCGATCTCCCGTAGCCGCACCTCAT
TCACCCCGCTGGCGCCAAGCTTCTTGACGATCCCGACCAGCTGAACCGCTCGCTCTGAGACGTGCACGGCCGTCAGCGCACGAATCTTCTTGGCTCGAGT
CGTGACCGAAACAGCGCGGAACTCCTCCTCCGCCAGCTCCATGGCAGCATCGGCCAGTACAACCGCAGCATCGATCAGTTCGGTTCCGCGCTCTTCAAAG
CGCTCGGGGATACCAAACTCTTGCAGGCGCCTCACTTCGGACTCATACAGGTTGTTCTTGAACACCTTGTGTTTGAGTTTGACGGCGTCTTTTAGGAGTT
GAGTGAACTTGTCAATGAGCTCAGGTTTGCCCTTGACGGTTGACCGCAATGTGGACGGAGCGTTCAGGATCTGAGCCCTCTTCGCTATCAGCTGGCCAGC
ATCGCGCTCCAAAAACGACAACGCCCACAGCCGACCGTACGCCTTGCCTGCATTCAGACGCTCTTGCTCGGAATAATACCAGTCTCGAGTTTCCTTGTTC
TTGATGAGCAGCCGCGACGACCACGTCTGAACGGCGTCAGTGCCGAGAGATAGCCCCAACGCTTCGATCTTCGGGCAAATAACGTTGTAGAACGCGATGG
CCTCTTCGTCCGTCGTCAGCTTGGTGGTCAAGAGCTCGTCGATGAGTCTGTTGACCTCCTCGCGACTCTCCACGAGCTTCTTGTTGCTCTCCTTCCTCGC
CTTCTTCTCGAGCTGCTCAATCATGCTCATTCCGCCGATGCCCTTGGATTTCTGCGACTCGTCGCCGAAAATGTCATCTATCGCGCTTTCAGCCGCTGCC
AGCTCTTTCGCCATCTGATCTTCGACGGTCTGTGGCCCGCTCAGACGGCCGTCAGGACCGCTGAAGCTACCCCGACTCCCCTTACGATGGGATACCCCAC
CATTTGATACTGCAGACAACCACAAAGCAGAACAGCTTAGCACACGAACGATGACACCTCATCAATAATAGCATTGCACCTTGCTGGATGATTTGCTGGT
GCTGCATCAAAATACTGAACAGCTGTTCCATCGAGACCGGGGATCCTGGAGCCATGCCTTCTCCACTGAATGAAGGTGGTGGCGGCGGCTGCACAACAAT
TTCACAAGTTATATCCAGTCCCAGTCCCAGTCACAAGACAGTCGCAACAATGACTTACCCCTGCATCGTTTGGCGAAACTTCGTCAGGCTTATCGAGCAG
TTCCGGGTCGGCCTCTTCTGCCTTCATTTTCAGCTTCACTTGCTCGTCTGGCATCCCCATTTCGCGCAACTTGAAGTATTTCTTGTACTTTGGGTCGTCT
TTCACCAGCAATGGCACGTAAGGTGGTGGTGGCGAGGCTGGAGCGACAGCGCTCGGAAATGATATCGGTGGCAGGTCTGCCAGGCTGAATCGCATCCCAG
ATCCTGGAGGGCTCGACACCGGCGGCGGCTTGAATACGCATGAAGTCAGTACACACGCGATAGTTAATCAAAGAGAGGCCATACAACACGGCCAATTGAA
CGTACCCCTTTGTCGTTGGGCGATATTTTGCTTGGGTTGTCCAGCAAGTCTGGATTGATGCCGTCCGCCTCCATCTTTAGCTTGATTTGGTCGATTGGCA
TGTTCATCGTCTTGAGTTTGAAGTATTTCTTGAACGCGGGGTCGTTCCCGACCGTCAGCGGCACGTAAGCTCCCTCAGCAGGCTATAGCAACAACAAAAG
AACCGACTCGAGTGTGAGTGCACAAGCTCAGATCGTGCGCATGTTGAGTGGTACGTACACCTGGATCATTCGGCGATACCGCATCGGGCGTGTCGAGCAG
AGCTGCGCTCACTCCCTCAGTCTCCATTTTCGCTCGTATTTGTTCGATCGGCATCGACATGTCCAGCAGCTTGAAGTACTTTCGGAATGCCGGGTCGTCT
TTCACGAGCATCGGAGTGTAGACGCTCCTCGCGACGACATTCACACCGCCTCCGCCCGACCCTTGCGGAGCGTACGCGATGTTCTGCGTCTTCTTCTCCA
GCTCCATGAGCTTCCTCTGGAGCTCCTTGATCTCGGTCACGTTGATTGGCGTCGAACTGGACGCCATGCGAGCGAGCTCCTTTGAGTTAGATTTGTCCGA
CATGAGCTGCGCGATCTGCTGCTGCAGCTTGTCGATATCCTTGTGCGGAGTCATGGACTCAGCCTTGGCGGATAAATCCAGCAGCTTTTTGATCTGCTGC
GGTGTCAGCCCTGGAATCTGGAGCGGCCCACCACGGCCAGTTGCATTCGATCGTGAGGTTGACCGCGGAGCTTGACCGACGTCCTCGCTTTCCGATTCGC
TTTCGTCCTCGGACGACTCGGACTCGGACTCCTCGCTCTCTTCCTTCTGCATGCGAGCTAATGGAAATGCGAGATGAAAGATCAGCACCAGGTGTTTGCA
AGTACTGCACATTCAGCATGCCTCACCTGAAATGCAGAACGCGCGGTGCGCTTTCGCGTGGCGCATCTTACAGACCTGGTGCCGCCATCATCAATACAAC
ATTAGCCAAGATGGACTAGTTCGCTTCGAGTCGGACTGGCGCTGCACCTCGTTGCAATAGTACGCCTCTTGACAGATCGAGCAAGACAACGCCGCATTTG
GCGTCCCGCAGTACGCACAGTCCTCGCCCGGCCCAGCACTCAGCCGCTCGAACCCCATGGTGCGCGTCAGCCGGCTCATGAGCTCATCGTCGCTGTCGCT
GTCGGCCATGGTCACCTGTGAACCTCGCGCTCTTTTTGG