Description :
From Genome Similarity Track
Location :
Scaffold_430:2752- 8140
Sequence
5388 bases(100 bases per row)
GAAAAGACTTATGCTTGTGTGAGTCAACACTACTGGTGGCCCAAACTCAACAAATGGGTTAGCACATACATTCGTACATGCGAAACGTACCAGCGGGTCA
AACCATCAGCACATTCGGCTGCACCACTCGCAAGTTTCCCTGTGCCCACGGGGTGTTGGGAGTCTATCAGTATGGATTTTGTGTTTGGTTTTCCCGAAGA
CTGTGAAGGCAATGCGGGAATTGTGGCCTTTGTTGATCGTTTTTAACCAAGATGGCTCACTTGGTGGCGGTGCCGGATTTTATCAATGGCAAAGGTACAG
CTATGCTGTTTATCGATCGTATGTTTCGTCAACACGGGGTGCCGCTGGCAATCATCTCTGATCGCGACCCTCGCTTCACAGACAAGTTTTGTACTTCCAT
CTTCAAGATGCTTGGCACGCGATTGGACATGTCCACTGCGGATCATCCGCAGACTGAAGGTTAGACTGAGCGAGTTAATCGCGTCATTGGCGACGTTCTT
CACAGTGTTTGTACTGAGTCTCCTAAGACTTGGAGCTCGATGCTCCCTGTCATTGGTTTAGCGCTGAACAACGCTGTTCATGTCTCTACCGGCTTTACTC
CCTTCTATGTGAATAGCCTCACGCACCCCCGTGTTCCGCTCACGTTACCACTACGTGGTTCTGGGATTGGTGGGGGAGAATATGCTGGCAAGCTTGCTTA
AATCAGCCCTACCACGATGCAGAAATAAGTGAGCGAGTTTCTCGCAACGCGCTTTAGGGTCGTACGATATGTGCGTGATGCAATGGCTGATAGCCAAGAC
AAACAAAAAGAACAAGCTGATGCTAAAGGCATAGACTATATATTGATTCTTATGAAGTTAGAGACAAAGTCTAACTAAACGCCAAAAACCTACCTATAAA
TGTAGTGTCTGCCGTCTTCAAGACGAAATTGCGTCCGCGCTTCATTGGGCGGGCGTTTACGGTCATAGCGAAGTAAGGTCTTGCCTATACACTCAATCTC
CCGCGCAAGTTGCGCACCCCCCCAGTGTTTTACGTTAGCTTGCTTATGCCATATCATGATCCTTCTCTCGTCAACCGGAAGGCGCTTGCGCCTGAAAGAG
GGACGTCGTCTCCGCTAGCTGCATCTTCGTCAAGAGCTCCACCTGGCCATCCAGCCGTGGTAGGTTGTACTTCAACTTCCTCAGTCGCTTGTCGACCGAG
TAGATCTAACCGAGACGGTTCATCTGCTCACTCAACTAAGCCAACTCAGTCAATGACTGTTCATGAGCGTGTTGTACTTGGTCAAGGTTCTTCCGAAGTT
GCTCCCTCTCAGTCACAGACTGATCCAGTGCCGTCTGCACGTGAGCAAAAGACTCTCGGAGTCACTTTACCTCTGACACCAAGTCTTCATGAGTATGCCG
ACACATAGACCCCCTACTGCGTTGCTCGACGAGCAAGGGAACTTACAGTTCCATGTGGATAGACTTCTGAAGCGGCGTGGTCACAAAAGTCAATACCAGT
ATCTGGTGAAGTGACGTGGTACCCTGAGTCCGAAAACCCATGGGACGTTTGAGATACCCCTTCGGCAAGATTGCCCGTACGCCGTTGACTTTTTTGAGTG
TCGCGCTGCGGGTCAGCTTGCACCCCAACACGCTTCCCACCAAAAGGTGTGGGGGTGTAGGGCTCGCTCACCAACACCGAGTGACCCGCGACTGTCTGCA
CAGTCAAAACAGTGGCGGTTGGACCAGCAACTGGTTTTGCGTACTGCGTGAGATACAGTGAACGTAGCTGGCCGTTGTCTTTTAGCTTAGCAAACTCATA
GCGCAGCTTGCGCTCTAGCCTAACGTCGTCCTTAGAGACACTAGATCGAAGGACACTCATGCTGGGCAACCGACGTGGCTTATGTGCCCAACGAGTGAAC
GTGCTGTCATCTTTGGCCTCACTCCTACTTGGGTATAGAACGACCGGGATCGTTCTCTGCGTCGGTACAGAGGCACCATGTTCTTGTTTCGCTAACTTAA
TTTGGTAATCAGAGATCGTCGTCGCTTCGGGCGTCAAGTATCTCTCCAAGAGCATCTAGTTTGGCAGTGTCGTCAGACGTTGTAGCCTCGCGCCCTGTGG
ACCAAGTAGTCAAGGGCTGCCCTGCGAGCTTTTGCAACAACTCATCAACGCTCAAAAGCTTGAAGCAATAGTCAGAATACGCTTCTGCAATAGCTAATGT
CTGAGATAGACGTCAGATCTCTCATTTTCCTCGATATAGCGTTGCTGTTGCTCATCGAGCTTGTTGGTGATGGTAGGCTCAGTAAGAGTATTTGAGGCAC
GCAACGCAGTTAGCGCTAGAGCCGTGCTTCATTCCGAAAAATGGGTTTGGCACTATGCGAGAAGGTTTGCACGACGCTGACGTGGCAGGTTCGGGGGTTT
CACCCTCTTCCACGATGGTGTCACTGTCATAATCAACGATATTCTCTTGTTGTATGATGTCTTCCAAAGACTCGGAGGAATGCGAAGACTTCGCCATTGA
TGCGCAAGGTGTCGTGAACACAACCGTAAGGTCATCTGCTCTCTCCGAGCTATCTCAATGAGAAAGGTGAAGAATGTCGTTTCGGGGTATCGACTGTCTG
GTGGGGGAGGGTGTAACAGAGTTACACAAATGGTTGTGATAACCTGGTACATTGGTGTGGTACACACAAAAAGAGATCAGTATCACTGATAAGGCGTACT
TTTGTATCACATACGCTAAGCGATAATACCGTACCCTATCGTTTATGGTTAGAAAATATATATCGTAATAGGGTCTTCATAGAGGCGACGTAGTTCTGGT
GTGGTACACAAGAAGAACTACGATGAAGACTATTCGATTAGGTAGCATAGTATAAAGGTTAAAGACGTAAGTAAGGTTTGTTATCGCTATAAATCAGTAA
ATATATCCAGTCCCCCTTTTGATCAGTTTCAGACACGTGTCTTTCTAAGACGTCTCTGGTCGTAAGAGTTAAGTGCCTGAGTTAAGAATAAGTACTCTTG
GGCATTAGTGCCACGTGATTGCTTGGAGTCGTAGTCCCCTGAAGCAGGACTAGAAGCTTAAGAGCTTGTACATACACTTCGACTTAAGTCTCACTAAGTC
TGTAAGACTTGAGACCCTTTAAGTTAATACCCGTTTAGTTTGATATACTAAGAGACTCTACGAGTCTAGAAGTCTTCCTCTGAAAAAGGAGTAAGGGTAG
CTCTGCTACAAATGATGTGCTTCCGTTGATGGATGTAGTATTGATAATACTACTCGGAATGTTGGCGCTGAAGGTGGTAAAGCCCGAACTGTAACGGGGT
GCCTCCGTTACATGATAAATTACATAAGGTAATTATCAAGTATGAATATTATGTTAGGACAAACACAATATTCTCACAATATTATCCCAATAAAGAATAT
TGCCTCGCAAATGTAACACACTGCTCACTCGTTGACATAGGATCGAGATATCAACCAATAAAGTCTAGCCACGACAGAAGCACGCAATGAGTGGTGCGCA
GATAGTTACAATACATGTTTGTATTTGGACATAGCTAAATGAAGTCAACTAGGGATGTATTAAAAGGGTTAACTAAACTAAATACAGTTCTATTTTTTAT
TGTTACTGAGCACTCTTACTCCGTATAGCAATCTTCCTCTGCACGTACGTGTACGTGAGGTAGTCGGACGCACACACCCTTGCACTGTCAGCAGTGCAAG
GTTTATTCGGTTAATTGAATAAGGTGTGCCAATTTTTACACCTGGTAGCACTTAGTAGTCCGTTCAACGACAATGAACATGTTCGACGATGAGGGGGATG
ATTTTCATCCCACGCATGGAAGCTACTCCCATTTGAGTCAAATCGAATGGGATGCCGTCGAACGCTTGAGTTCAACGATAGGGTAAGAAGCTGTTGGCGC
ATTGCTGTCCGCCCTGGGGCCAGACGGGCAACACGCCACCATCGCCAAGTTCATTCAGAATGAACTTGACGTCGAGTGGGGAAAGGTAACCTTGCGTCAC
CAACAAGGGTCTCAACAGACAGAGCTGTTGAGAGAACAGAATGCTCAACAGTTTGAACTGTTGAGACAGCAGCAGACCACTGCTACCGGGTCGACGTATA
CACGTCGACCCAAGACTAAAGATTGACATTTCAAAGTACAAGGGAGCCGATGAAGACTCTCTGTTGAGATGGTTTGTGGACTAGACGATGCCATAAAGGC
TCGCCACATCGTCGATGATCAAATGCAGATAGCATTTTCTCAATCGAACTTGGCAGGACGTGCAAAGACGTGAGTCTTGGGCCTCAAGCTATACGACCCA
TATGTCTTTGGGTCGTTGGAAGTCTTCAAGTCCCTGCTTAGGCAAACTTTTGATCTGCCGCGAGCTGAGTTCAGGGCTCGCTCTGAACTCCTGAGAATCA
AGAAAGGTAAACGTGACGTACACTCGTAAATTTAGTACATACGTCACCTTACCAGTTGCATAACAGTTGACCCACTGAACCAACAAACGTTGATTACGTT
GTTCATGCAGGGTCTGACTGATGGTCCTTTTAAAACCTACCTGTTCCGGTTGGAGTTCAACACCCTGGAAGAGGCGATAAGGGTTGCGGAACAGGAGGAC
TTCAGCGTGAAACAGGCTCACGCGAATTCGAATTCCTATCGTCCGTCGAGACGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGTCACGCGGGGA
TCGAGAGCTCTCGTGTTAACAACTAAAAGAAATTGCAAAATTCAATAGATATCAGAAGACAGGGCATTATGCATACGAATGCAGTACCCCGAACGCGGGA
CCACGTACCGCAGGAAACAGTAACCGCTAAGCGGCCAAGCGAGGTCCAAGGCGTGGTTCCGACGTTGTTGCGAAGACGCAACAACGTAACGGATAGCCTA
AAAATGGTCGGGGTTAGTAGGTGCGGAGCACCCTACTGATCCAGCAACGTCAAGTGAGTTTGCAGGACTCTTGACGAGAATTGCTTCCAACACTCAGTCA
TTGAGTGTTGCTGCTTCTGGTAATGAGGGTTACCTCATTACCATGAAACACGAAGTGATACAAAACATGTCGCTTCGAGCCCTAGTCGATTGATTGTGGG
GGGGGGGGTCGAACAACTCTGTATGACGCCAATACAACAGAGAGCTCTAATATATATAGCGCTAGATCCCTCCAAAGAGGATGACGGTGCGCCTCACGAC
AGGCGCATCCGTAATAGTGATGAAATGTGTAGTAGGAATTTCTCATACACTGAAAGAAGTCCAATACGATGATGACTTCATCGTCTTGGACTTGGATGAC
AAATTCGATGTTATCCTTGGTTTACCGTGGCTTAGAAGATACGAACCACAAGTCAGATGGCATCGACGAAGTGTCAATATTCCTGCCG