Description :
From Genome Similarity Track
Location :
Scaffold_4:27510- 28572
Transcript NameFunction/comments
Hyaar_Emoy2800741hypothetical protein

Sequence
1062 bases(100 bases per row)
TACACGGTCAATGCTGTTGTCATTTTTTTGCACAAGTGCACCGCCGATGGTCCAATTGCTTGCAGACAACACTAAAGGGCTTTTCCTCGTTTGGCAAAGC
CAAGACCGGAGCCCCTTCAAGTGATTACTTCACTGAAGTTAAGTATCTACTTAAGCCTTAGACCAAGTCCACCCTTCATCCTTTTTAAAGGGGTCAGACA
TTGTTTTGGTTCACGCTGCATAATTCTTGTTGTATTTATGCAAGTAATTAGGAAGCCCAAGGAATTGGTGCAGATCCTTCATATGTCGGGGGGGCTGGCC
ATTCCTTTATAGCCTTAACATTTTCTGGGTCTACTCGGACACAGTGTGTTTTCCCACGATGCAGCCCAGTACAGGTATTTCGATGACCTATGACGCACTT
TGCAAGTTAACGTACAGTTGAGCGTCGCCCAGAGTCTGCAACACAACGTCCAAATGACGTTTGTTCAATTCTATCTCTCTCAATCCTTTCTCGGCCTTAA
TATGAACGAACGTAATGTCAGATTAATGAGACGCTTAGGCATGGTGTGGACGCATCACATGAGCGATGACCCAGTTAAATGTCGCTGAAGGCATCACTAG
CCACTCCCACATCATACAGCTTGGGGTGCTAACTTCAGCCTTGGATACATCGATCTTATTCATGAGTACCTGATAGTATCCATACTTTAACTTTTATACG
GAAAAGATAGTCGACTTCCTCATTAAATTTAATAGGGCATCTTTTTGGGGGATCGATATTCGCTCAAGGATGGCGGCCGTGCCCAACTAAGCATGAACTA
CGCGCCCACCACCTGTGCCCTTACCCACACAAAAGGTCGGGCTGAAGTGAGGTAACTTGCTCTCACGTACATGTCTCGCCTTGGCTTTCTTGTCGGAGAA
CTAGTCGAAAAATGGTTGATATAATCGACCTGTTCTTTCGGCAATGGCCACAGCCTGGTCACAAACTACTTGGTGCCAGGTTCCAAGTCAATCTCTTGTC
TGATCACCCTATCGGCCGGTAGGCGGTTCGGCACTTCTGTTGGAAAGACACCACGGTGCTTC