Description :
From Genome Similarity Track
Location :
Scaffold_9:275069- 277652
Sequence
2583 bases(100 bases per row)
TTAGTGGTAGTTTTATCGAAGAAGCACATCGGTGTGCGAATTGAAACCGAAAGAATGTACGTCTAGGCTAACAGTAACGCTTGTAATAATTGGATCAATT
ACTTCATCCATTGAATATAATCCAGCGAATGAAAGAATTCCATAAGATGAGTAATGCGCGACTTTGCGATTAGATTAATGTGCAATACAGCTATTAGGAA
TGTGCAGTCGAACAATTCAGTAGGTTTAAAGTAGAAATAAGAAGTTAGCAAACTAACGATCTATATATCTCTTCTTTGCATTCTGTATCGAACCTCCTAA
GTGCCTTTACAACATTTGTCATCAATTCTCCTCAAGTACGAACGCAACGTTTATTGCAACGGGGTTACGCAAACGGTCGTCATAACCGGGTACGCTGGTG
TGATACGCACATATAGCGATCAGTGATACTGATAGGCGTATTTTGTATCACATACACTAGCGGTAATACCGTACCTTATCAATTACGGATAGACGGTATC
TATCTTATTAGGGTCTTCAAATTACGGCGTAGTTATGATGTGGTAACACCAGAAGAACCTTAAACATGACTACTCGATTAGGTAGCATAGTTTCAAGTTA
AATACGTAAGTGAGGTTTATTATCGCTATAAATCAGTGAATACATTCCGTTCCCCTTTTGGTCATTCAACGACACGTGTCTTGTCAAGACGTCTTTGGTC
GTAAAGTTAAGAGCCTCTATTGAGTCTAGTACTCTTGAGAATCAGTGCCACGTGATTAGTGTCCTGAACCAGGACTAGAAGCTTGCGAGCTTGTCAAGAT
ACTTAGAGTTAAGTATCACTAAGTCTGTAAAGACTTGAGACCCTTTAAGCTAATACCCGTTTAGTTAAATATACTAAGAGACTCTACGAGTCTATAGGTC
TTCCTCTGACGAAGGAGTAAGTGTAGCCCCTTCACTTATCTTTAAAAAGACACTTCTTTTCCAGATGTTTGAGGATAAATCAGGGATCACCCGCGCTCTG
GTCGCGCGGCAAAATGCACAAGTTACGACTGTAAGAACGTCAAGTCACCTTTGCACTTGCCGATCAAGCAGCAGCTTTTGTGTGGCCTTCAAAAGGCTAT
CGAATACAGATGATTCTGCCTGAGCCATCACTTTCCCACAATATAAGACCGTGAACACTCTTCTTCTAATACTCCTGGAAATTTCTTATGGTGGTGACAC
ACTTCGATATAGCATAGGGTGCTTCTCACTAAAGTATCCGCTGGCACAATCGAAGCGCTTTTGTCGGTGAGTGTCAATTGCCGATACTATAGGTCTCTCG
GTCACCGTTGAGGTGTACGATTCAGTTTTTGTGGTGACATTTCATGCGCAGGTATGGCCGCAGAAGCATAAGATGGCCACGCATATTTTGGCAATGATGT
CCCATCTCTTCCTGTACCACTTCCGCCATTTTTAGATATTCTCGAATTTAGGATGCTGCTTGCAATATCACACGATCTCACGGTGCCCCAAACAGGAATA
TACCATCCAGCGTACATACTACAGTACTTCTCTGTACTCATCACTCGTTGAGACTGGTACTTGATCTGACGCTTAATCACTTCAAATAAGAGGGTCGTAT
CGGCCACATTAAAACGATGTCCGTTTCCTCAACGATAAGAAGATCAGCCTGAACGAGGAGACACGCAAGACGACCCTGTTTGTGTTCATGTACGCAACGT
ATACTATGGCGACCGACGCATCTACGTGCTTATACCGGTATCCGTTCGTTTTGGCTTCAACTGAATAATTTCACCCGCAACAGATGGAGCTTAAAGGTTC
GCGCAGGGTGGCGCAATCATCCGACGGTTCTTTGACACTGGCGACTGGGAATCATAAAGAAAAGAAGAAAAAGAACACAACCCAAAGTGGTACATTCGTG
GCAGTTGACGCGAGTCCCGCGATATCCACGCGCAAAGGGTTGAAAAGATTTACAAACTCACCAAAATCTATGCCAATGAATGGCGCAGCGGACCCGAGGG
GCCTGCTTCCGCTTCAGCTCTCCAATTCCGTCCGATACACTGATAAAAGTCGAAGGGGATAATAAAAAAACTTTCCACTGCTACAGAAAAAAGCATCTAC
GAACAACACGACCGCGTTGATCACACTATAGTCCGCCCCACAAACGATATCACTAGAATAGCTACATCAGCTACAACATGGTATGCCATCAGGCACTAAT
ATGACCATCCAGGAAACTGCTTGGCAAAGCAGGGGAAATGTGAAATGATCATTCATGTTTATCTCTCCGACCACTTAAGTGGATGCAATGCACGGCCTGT
TGGCTGATTTAGGCCATTTGCGCTTTACAAAGTATAAATAGAACCGATGCTCAAGCTGTAATGCTTTTCCAAGCTGTCTGGTAGCTATAAGCTCACACTA
GCTATCTGTATCTTTGCGCTTACTTGATCGACTTAATTTTCATGTCTTTCGCCATCTGCACGCTTCTTCACCAATCGCGTCATTTGGTTTCGTCTCCCAT
GCATACCCCAAGGCGTCGATAACGTTTCACCAGGCCTATGATGCTACAAATCGCGACTGCTAGGTGCCCTTCATTTTGATCTT