Description :
From Genome Similarity Track
Location :
Scaffold_322:27500- 30140
Transcript NameFunction/comments
Phypl_g6955hypothetical protein PHYSODRAFT_361457
Phypl_g6956conserved hypothetical protein

Sequence
2640 bases(100 bases per row)
ACACGAGCTTTGGGTCCGCTTCAAGCTCCGCAAgcaccttctgctgcagtGACGGCACTAGCGGTTTCTGAAATGCGCGCAGCATAAGCTCACGCAGCGC
GATACCGTGCGTCGAGTCCAGCATCGTCGAGTCCCACAGCACCGTCGGGCAGTAGTCCGGGTTTAACCAAATCAACTCGGTCATATCTGGCTCTAGAATA
GGCGGGGGGAGACGCATAAATGTCGGCTCGAAGCTCAGTAGCGACAGCGATCCGGTAGAAGACGCGCTAGCAGCAGTACTAGATGACGCAGCGGGGGTGC
CGGACGATGCCTCCGCATCACTAAGCAAGCTCATCTCttccagcgacagcgcttCAAAGCACGGCAGGTTCAACGAGCTGACTTCATTCGGCGGCACCTG
CAGATTGGCGCCATTGTTCACGTGCTCCTGCAGGTCAAACTCCGTGTCCGTCACCACATTGCGGATACCTGCTGCGCGGAACTGAGGCACCGACGGTGTG
CGCTCTAGGTAGCTGTTCCtcatggcctccacgtcAAACTGAACAGGCTGCGACGGGTTCGTTCGGAATTCCGCCATCAACTGCTTGgccgtcttcttgc
tcgactgcagcaaataatccacagcaacagcgtcagTATCACGATCTTCCCACCATCAACAGCTCAGGAAAACAATAAAAATCCTACGTCACGAGTAGCG
CCCGTCGCCGACAGCAAGTGCAcgatgaacttcttctcgcacAGGTCGCTGCCCTTCTCCAACGCGTCCAGGAACACGGGCAGGAACGGGTTCGTTGTGG
CGCCTTCATTGCGATACAGATCGCTCAAGATCGAGAAGCCCACGATGCGCTGCAGTAGAACACACACACAGTcccacgcagcagaagaacgTCAGTTCCT
CTgtcaacaagcagcagtcCACCCCAATGGTAGAGTAGGTCTCAGCCCGACCTGTGAGCTCGTGAGCAGgttgtcctgcagcaggatgcAGATGGTGCAG
CCCACTTTGAAGTGGTCGTTCTTGGTGAAGGTGCGCAGGAACATGCtggccacctgctccagcggcttGTCGTCCTCCTGTAACGCCatgcacacacaca
cacacacacgtgAGCTCTTCGTCATTAGAAACCGCATCAACGCATTTCTAACGCTTGTTTCTATGGGCTACGCTTCTGTTACGAGGATCCTGCGGCCAAT
ACGAGACGAGCGCGACTGGCGGCTGCGAGGTACGCACATTGAGGATGGCGAGAAGCGGCCGCAGCTCTCggatctccagcatcgcggcgggggggggggg
ggggggagcgAGGGGGACGAGGTCGGCGCGGAGGCTtctgcttgtgcttgagTGCTAGGGCGCTGGGGCTTTTTCGCCTCAATGGGAGGAGGCGACGGAA
TGCGAACTTAACGCGAACTTACCGCCTGAGAAGTGCCACAATCATTTCCGCCTGACGTGTACTTAAGTATCAATCAATGGCTCCATCTGCGGTCTCCGGG
TCGGTGCTGGCGCGCGTGCGGCCTTCGtgcgcgaagctgctggcgcacgagTCCTCGTCCGTGCGCATTAATGCGGACAAAGTGCGCGCGTtcgaggagg
cgctggacgccaaggagtttcagcagctcgcggagcCCACGACCTTCCCGCTCAACTTCCGCtcgcagcaggacgaggtcAACTTCCTCAGTGCGTAGCG
CTATGCAGAGGCCGCTGCAATTGGTGACGTGTGTGTGCTGACGTGCTGGTGATGGATTGCAGCGCTTTATGGGCTGCTGAACTTCGGTAGCGGCTTCCGG
AAGGACCTGCATAAGTACGCggatcgaggagctcacgacACCATCGTGAGTGCAGATGTGTAGGCGTTACAGGGGAAGTAAGAGGACTGACGAATGTTTA
TTTGGTTGTGCAGGTGTTCGGGCTCATTGGCATGTACATTTCAACACCCAGGCTGAACGCCCAGTTCATGCAGAACTTGAGCATTGACCTGGTGGCGAAC
TACTTCAGTATCCCactggagcaggacgaggaggtgtCTCCGGGCATCTACATGGCCAAGCCGGTATGGCGCAGAAGTTAGGGGGAGNGGGGGGGGGTAT
GCTGTCTCGGGTACTTACTGCTATTGTGCACGGCACGTTTTGCTGTTTGGTTCTTGGATGAATGCAGGGACCGCTGAAGCCCCTGGCTGTGATGATCCAG
AAGGTGAGCGATATCAACACCCTCCGAGTCGAATTTGAGCCGTGGGAAGGCTAATCTTTGTCAATATGTCGGTGGTTCTGTCGCCTATAGATCTTGAACG
AGTGCGGACAGAAGCTGGTTGACCTGAGGATGGAAGATTTCGGAGCGTTCGTCCTCGCCAACCTCTCGCCGAAAAGCTctggcgagctggaggagaagga
agctgTCGGTCTCAATGCCAGCGCAGTGCACCTCGTGGACCGATTTGTGGCTACGTTCCCGGGCTTTGACGACCACTACGAGATCCATGGCGAGAGCGTG
TACCTCCTCAAGCGGGCTcagctcgccgtcgtgggcATTCACCGTCGGTTCAAGGTAAACCCCCCACCGTGAAGCTGATCACAATGTCTGCGTCCAAACT
AATCCGTGTGATGGTGTACTGTGTTCGCAGGACTCCGACC