Description :
From Genome Similarity Track
Location :
Scaffold_1124:2750- 5658
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1124-snap-gene-0.6Cytochrome P450
Pytiw_DAOMBR242034maker-piw_contig_1124-fgenesh-gene-0.3Phospholipid-transporting ATPase

Sequence
2908 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTGTGTGCGCGTGGTTGAGCGCCAGGAGCGACTTGCCAAACA
CCTCGCCCACGCACGCGATCATGTGGTCTGACTTGATGTAGTTCTTCAGGTTGCCCGAGAGCATGTGCTCGACGTCCTTCGGGTCCGAGACCTGTTGCAG
ATATAATAATATAGCTATTAAAATATATAGGCGGATAGGATATGGAGAGATGAATGGAGAGCAACACGAGTACGTACGTAGAGCATGTTGGGGTTGAGCA
GGTTCCAGGGCATCACCACGCGCTCGCCGTACTCTTTGAACAGGTCCATCTGAATATAAAATATTAGTCGATATTCAAACATTTCAAGATGCATCCAACC
AGAGGTTGTACCTACCTCGTAGTCGAAGAACCGGTGCAGGTTCTCGGTCATCTCCGGCAGCAGCCCGAGCAGAAAGCGCCCATTGGGTCCGGCCACGGGC
GCCAGGAGCTTCGCGCCGCGCATCTTGCTGCGGATTGAGCTGCCAATCGCCACGAGCACGCCCGTGAGTGCGATTGTGAGAACCGCAGTCACCACTTGGG
CGACCAGAGTCATTGAGACTGGGGGAAGCACGAGCATCGCTGCTGGCTGCTGAGAATGCGTGTTGGCTCTGGATGGCGAGTTGAAGAATGGACTAGCTGG
GTGGCCATCGATGGAACCTTGCTTTGCGAGGGAACGCCTAGTCTGCCAGAAAGAGCAACATGATGAGTACTGTGGGAGCTGATGGGATTTTTTCAAACGG
TACTCACCATTTTGTGCATGTCCGAACGAGACTTTGCCACTGCTTTAGGATTGGACTAACCATCCGATGATGCAGTACTGGACCGCTTCTTGTAAGAGCC
TAACGCGTTGAGGTGCACGTGCAGTGTTGTGTCGCCATTGTAGTGTAGGCGTTGTGCTGTCAAGGTGAGGAACTGTAGTGCGGGTACTTGCGCAACAAAC
GAAGCACCTAGCAAAACCTGGCTGGCATGTGCTCGAATTTTGATTACCATGGCAACAATGCATGTGGAGGACAATAAGCGTCCTTCTTCAGGCGACACCA
TTGGAAATCAACACCAGCTACAGTCATTTGGAAGATCAGCAGGAGTTACTGTTGGGAGTACAGGCGTCGGGTTCAGAAGAATGCGAAATGATAGTTAGAA
AGAAAGGGAAAAAAATATTAGAAATAGGGAAAGCTGGAGAAGGAGACAATGGGGACAACCGACAACGAGACACGAAGGTCCCAACTACAGCAGACGCTGG
CCACCAGCTAAGAATAGCTCATCCTCATCCGATTGACAACCTTAAATGGACAGCACCGAAATGGATCAAAGCTGCCTGAGCCAGTCGTGCGCTGACATTC
TAAGGCATGTGCCTGCTGATGGAGTTTCGCAGCGCCGCCGGCACGGCGTCCGAGCGCGGCAGCGAGTTGGACGCGATGTACGACTCGGCCAGCGTCGTCT
CCTCGTCGCAGCTGAACGCGTAGCCCGTGTTGCGCCGTGAGGCGCTCGTGGTCTTGAAAAACTTGGGCGCCCACGGGCCGCCCGACGCGCCCAGGTCCTC
TGTCACGGACGAGCTGTACACGCTCGCCGAGAAACTGTCAGCCGTCAGCGACACGTTGTCCGACACGCCTCGCGTAGACGGGATCTCATGCTCCTCGACT
GCGCTGTTGCTGTTGCTGCGGGCATGAAGCAGCGTGCCGCCCGAGTTGGTGCGATACGATTTGACCGTGATGTCCGTGCCGCGGAAGTCGCTCATGAACC
CCCCCGCGTGGTTCACGTCGTCTAGCGACATGGATAGCGTCTGCTCCTCCACGTGGTTGATCGTGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTTCTGGCGCTTCTCGACCGACTCAGACAGCACCTGGTTCAGCTCCGGGTAGAA
CGTGCGCTGGTACTGGCTGTACGCAAAGTGGCGGCCGAGCGCGATGACGCAGCCCATGATCACGACTAGCACGTAGCCCCAACTCCAGGCCGTCGGCAGG
AAGCTCCCGAACTCGTCGTAGGCGACCTTGAACTTGGAAAAATATGCCACCTCGGTGCCCATCGTCGCAAAGGCGAACCACGAGAGCACACTCAGTGACC
AGCATGTTAGCGATAGCAGCGTCCACGTATCCGAGATGAGCCAGATCTTGAGGTTCACGATCAGCACGGTCATGGAGAACGCGACCATGCCGTACTCGAC
GCGCGACTCACTCCCCGGGGCGTTCTCCGACGCGTTGAAGCCGAACGACATCACGATGAAGATCACGAGCGACTCATACACTGCGGCGCCGACCCAGCGC
AAGAACGTGTACATGTTGAAGTAGTACCGTTCGGGGCCCTTCCGATACAGATCCGGGTACTCGAGGCTGAAGCTCGCCGGCAAGTCTTTATCCATCACCC
CGACCACGATGATCGGCAGACCCGTGAATGCGACGTTGTACACCTGCACACCCAGCTCCCAGTACATCTTGGAGCCCGAGGCGCCCGAGAGGTAGCCGTA
CCAGTACTGCGCCAGCACCAGCGTGATGTTCTTGTAGAACATGTACAGCACGAGCTTGGAGATGCGGATGTAATTCCAGCGGCCGTGTACGAGCAGCAGC
CGTTCCAGAAAGCGGAATTGCGCGATCGCATAGTCGCTCGAGTTCACCGCCTGCATACCTTCCTGTCCAGAGATGCCAACGCCAACGTGTGCAGCCTGAA
TCATCGCC