Description :
From Genome Similarity Track
Location :
Scaffold_1869:275- 3578
Sequence
3303 bases(100 bases per row)
TTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGTCCACTGTCCCAAACGTCCTTGTAATCCGGCCTTGAACAGCCAGGCTAGCGTAGAGTGTCGAG
TCAGGATCCGGATGGATCCCCCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCGGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTC
ATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGAATGACAGATCCCCTCATGTGGTTGTACCAAGGCTTCTGAGACCGCCCAGTCACTGGAATAAACT
ATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACC
GAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATTCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTC
TTCTGGCGTCGTACCACTTATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCGAA
ATCTACACCTCTCAATTCATACAATACCGCGGCAAAGAGAGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAGAGATTGCATCGCC
CGTTACGACTGCGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATTCCTCCTAGGAACTCGATGGCCTAAGTAATCCACCTT
GCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCTACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGAT
TCCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGATCCCCCGGCTCTCCTGCCTCAAATGGATCTACTTCCG
TATGATCTTCCCCGAATCCACCCCTTTTGAGTTCCGGTATTCGAGTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGCTCTC
CAATCCAAACAGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAAACCG
CTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATTGAGTCAGGCCGT
TAACCAGCCGGTAATCTATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGAT
CTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACA
TCGATGTCACATTTGACTTTGCGGGCAGCGGGCGGTAATGCATTACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATTTTCTGACGTAACCGATCCA
CTTCCGCGGGCTCGTTTGCCCCTGGATCCACTTGAATATCGTCAATCATGACCTCCTCTGTGGTTAGTGGTACCTCCGGGATTACCGCCAGGCCTTCTCC
GAGATCTTTGGCGTGTAGATCCCCGCCTTCATGGTAACAGCCTTGTTCATCTTCCGTCTTCGTAGGATCCATCATTGGATCCGAACACCGCGGCCTTCGT
TCGCCTGGCAGTCCTTCTGTCTTCGGTGAATCAGGTACCCTGGTATCAGGAAAACCAACAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAGTCCGACG
GTTCTGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGGAAGCTTGGATCCACTCGTGGATCAGCGGATCCGGCTGTTC
GGCTTATGCCTCTGCAATCCTCCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTTCCCCGTCCTGGATCCAACCTCCACTGCTTGGA
TCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTCC
GAGCGATTCGATCTCGGTAGTCGCCTCGTACACCATATTTTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCG
TCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCT
GGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCAACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCCGGTTTCCCCGGGCTC
GATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTTGCTCCATACAACGGTCGCCGTCCGCTGAACTGGGATCCGCATCTCGTCAGGGAAACAAAG
TGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTATTATGAAATCCATTCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAGATGTCAAAC
CAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCC
CATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTTATTGTTGATCTT
GCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACAGCCTCA
GATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGTTTAAACCATCGACCATGTTGGCGCTTCTCCCAAT
AACCACGTGTCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGATATCTTGGCAACTGACAC
TTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGAGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACG
CTG