Description :
From Genome Similarity Track
Location :
Scaffold_53:274903- 278217
Sequence
3314 bases(100 bases per row)
TGCCGATGATCATGGGAGCATTTGCAAGCGATGTGACAGACAGTGGGATAACTACGGCTGATCCCAAGGTGTTTCACCGTAGGCTAAGAGTCATACTTCA
TCCAGCCGAGAGGGAAGGGTTAGTACGCTGGCGGTTATCGCCCTTCTGATCGAAAGTGTGAAGGGGACTCTAGGACGTCTCTTCAAATATGTGTTGGGCC
TAGATGAAAGTGATAATCGGAGGAGCGTCTGGAATAATTCCCCGAGATCGGAGATGTACCACTATGATCATACAGGATAATAACCCTAGCCTTAGCTATG
TTTGCGTCGAGGGAATAGATGGTGCTTCTTTCGCTCAGGCTACGTAAGTTTACTTTTGCAAAAATACTTGTGATCGCTCGCATGTTTATGGTGCAGCTTT
TATATAAATATGTCCGGTCCTGCTTCTCGGCTAACAAGAAATGGCATATAAGCAATAACTAACGTGGGCCAACCCAGACTTATTCAGCCGAGTAGGACTA
AGTTTAGGGCGGTGTGGCTTCCCGGGACAGCAACGATTGCTGCTATTTCCAGTGAGGGGGGACGGACAGTCGTCTTAATCATGAAGTAGGAAAGCAAAAT
AGCAGATAAAGTGATGTTCAAACTACAGCTTCGCGTAAGTGCAAAAATGTTTCGCTGAAGGGTTGGAAGCGCAGGGTGTGAGGAGAAACGCTAACTGGAG
AGGGAATGCGCGTAAACCGAGCATTGGGCATCGGCGGGACTGGTGCAGCAACACTCGATGGAGCCACGGAGCCAACGGCAAACCCTGGCTGGGTATTTAG
AGCATGCTGAGCTTGACTAACAATTCGATTGCCATCTTGCATCAGTGAATGGGCTTCAGCTTGCCGACGCGCTTCCTGCTCCCTCATAATTTGTTCTTGC
CTTGTCCGTTCTTCCATTAAACACCGATGTCGCTCCTGTTCTTGAATAAGCGCCTGTTGTCGCACCTCCTCGTGTCGGCGTTGTTCAGCTTGTAGACGTT
GCACTTCTTGTTGTTTCTGTAATTCTTGGCGCTGTCGTTCTTCTTGTTGTCGTCGCTTTGCTGCTTGCTCCTGTTCGTGCTGCTGCCTTTTCTTCAATTG
CTCAATCCGTGCCTGTTCCTGCTGACGATACAGTTCTTGCTGTTGCAATTTATGATTAGCTTCTCGCTTGGCTCGCTCCTCCGAGTTAAGGTTTTAGATG
CGGCGGGGATCCGTACGTTGAGACGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGCCTTAGCTATGTTTGCGT
CGAGGGAATAGATGGTGCTTCTTTCGCTCAGGCTACGTAAGTTTACTTTTGCAAAAATACGTGTGATCCCTCGCATGTTTATGGTGCAGCTTTTATATAA
ATACGTCCGGTCCTGCTTCTCGGCAAATAAGAAATGGCATACAAGCAACTACTGAAGTGGAGCCAAACCAGACTTATTCAGCCGAATAGAACTAATTTCA
GGGCGGTGTGGCTTCCCGGGACAGCAACGATTGCTGCTATTTCCAGGGATGGGGGACGGACAGTCGTCTTAATCATGAAGTAGGAAAGAAAAATGGCAGA
TAAAGTGATGCTCAAACTGCAGCTTCGCGTAAGTGCAAAAGGGTTTCGCTGAAGCCAGCATAGTTCTTCGAGGTATCGTGCAGTTATATCTGGCTCCGGC
CCCGCCAAATGAAGAATAGTCCCCACAGCCATATCGTTCATATAGAGTAGGACAAGCGTACAAGTGGTAATTGGACGTACCTCATGTTTGCGGCATTGTG
ATTTTACAGCCATCTATTAAAAGACGACCTCACAAAACTATGCCAACTTAACACGCAACCTGTCTTCGATGGCGCAAAACGCTTACATGTCCTACACACA
AATGGGAATTGATCAAAGCAGCCGCAACGCTCTGCCGATGATCATGGGAGCATATGCAAGCGATGTGACAGACAGTGGGATAACTACGGCTGATCCCAAG
GTGTTTCACCGTAGCCTGAGAGTCGTATCCATGTAATGCCCAAGGCTACCATGGCAGAGACGGATTCGCCGGGAAATAGCTCATTAAGGAAGAAAAATTT
TGCTGGAACTAACCGAAGTCAAAGTGACATGATGCTAGCGCACGTGCTTACCGAATCGCGTGATATCATCGACCCCACACATATAGCCGCGACGCCGAAA
CATCTTTGAAACAGCGCCTTGTCGACACCACCAAAGCGTCAAAGATCGAATACGAAAGTATCGCATGGCGGATACGCCATTGTACGTAGTCCAGCCGAGA
GGGAAGGGTTGGTACGCTGGCGGTTATCGCCCTTCTGACCGGAAGCGTGAAGGGGACTCTAGGACGTCTCTTCAAATATGTGTTGGGCCTAGAGGAAAGT
AATAATCGGAGGAGCGTCTGGAATAATTCCCCGAGGTCGGAGAGGTACCGCTATGATCATACAGGATAATAACCCTAGCCTTAGCTATGTTTGCGTCGAG
GGAATAGATGGTGCTTCTTTCGCTCAGGCTACGTAAGTTTACTTTTGCAAAAATACTTGTGATCGCTCGCATGTTTATGGTGCAGCTTTTATATAAATAT
GTCCGGTCCTGCTTCTCGGCTAACAAGAAATGGCATATAAGCAATAACTAACGTGGGCCAAACAAGACTTATTCAGCCGAGTAGGACTAAGTTTAGGGCG
GTGTGGCTTCCCGGATCAGGATAGATTGCTGCTATTACGGGGGAGGTGGGACGGGCAGCCGTCTTAATCATGAGTAGGAAAGCAAAATGGCAGAAAAAGT
AAGGGTTCAAACTATAGCTTCGCGTAAGTGCAAAAGGGTTTCGCTGAAGCCAGCATAGTTCTTCGAGGTATCGTGCAGTTATATCTGGCTCCGGCCCCGC
CAAATGAAGAATAG