Description :
From Genome Similarity Track
Location :
Scaffold_192:2749- 5975
Sequence
3226 bases(100 bases per row)
CTGTTAAGGGCTTTTTTTTTGAAAAACCTTGGTCGATCTTGATCGACTCCGGAGCATCCGGTAATTATGTCAGACGCTGTTTTCCTGAAAGAAATCCACG
TTTTGTTGAGGCGCTAAAAGCGCACAAGGGTGATATGATCACTGTTCGCTTGGCGACAGGAAGTCTAGTCACCGCACACAAAGTTCCTGTGAACTTGAGT
GTGAAGTTTTTCGATTTTGATAGTATCGAACGCTGTTTAGTCCTTGATTTGGACTCGAGATATGATCTCATTCTTGGTATGGCTTGGCTTGAGCGCCATG
AGCCATGAGCCATGGATCGACTGGAGGTCGAAACATTAGGCGCCACACGCACTTCCCCTAGCTGAGCTTTGGAGAGTCATGAATCCACTCCTGCTAGGAA
TCAGAAGCGTTATTGGCGCGAGCCACTGGCTGACAAGGTCAGTGTGCTGGACATCGGAATGTCAGAGTTAGTTGATTCTGACGATGTCAAAGACATGAAT
ACAGAGCAAAGCTCAATATGTGATAGTGAAGCGGCACGTACTCCGCTACGTGATAGTCGTTGTGAGAGCAACGTACTGAATGCTGAAAGCATTGCTGACT
AAGTGTCAAGTCATCGAGGGTTGAACCCATCAGATGAGCGTAGAGTGGCACGTAAATACCCACGGAGTGACGTTTGTTGTGATAGCGACGCGCTGAATGT
CGATGTTGACGTTGTTGGTTAAATACCAAGGCATAACAACCCGGCTCATCGGATGCACGTGAAGTGGCACGTAATCTACGTGATGACAACTTCATGTCAA
CTGGCTTGTAGTTGGATGTCGATAGCAACATCAGCTCTAGTTTAGATAAAATTACGTTTGATGATGGTATCGTTCAGAGAGATACGAATCACATAGTGTG
TAATGTGTCACAAAGTGATAATGATTATCAGCTGTATACACTCGTCAACGGAGTGACTAGTGCTTGTGATGGTAAAATTAGCTTCGGGGTATCCCTCGTT
AAGTTCTCTTTTCGAACTCGAAGAGTTGTCGGTCTATGAGTTTGATCACTCACTAGAGAATGGAGACCTTTCAGAGGTGGTAGTCATTCAACCCGACATC
ATAGAGTTGAACTCTTCTTCACGTTTGGATGAAGCCGTTCTGGAGGACACAAAAGCAGCACTCATTGCGCGAAGTGGGTCATCAATATTGAAAGACCCTC
GTGCTCCCTTTTATTTCTTAGTCAGGGAATTTCAAGGTGTGGTGTGCCACGATCCACCCTCTGTTCTACCTCCAGATAGATGTGTCCGTCATGAAATTGA
CTTAGTTCATGGGACGAAATACTGTGTCATATGACAGTGGCCCTTGCCTAAGGAGCAATGTGATGCCATTGATGACTTCTTTCGTGCTAAGTACGAGGCA
GGAATGATTCGTGAGAGTAAATCTACATGTTCTACACCGGCATTTCGTGTCAAAAAGCCGATTGGCAAGTGGCGTATTGTGAATGCTTACAAGCTTAATG
CGGCTACTTTTCCGGCAAAGACATACAGTCCTCGAAAGGATGTTCTTCAAAACAACATGGTTGGTTGTACTATGTATAGCGCACTCGACTTGGTTGATGG
ATATTATAAATGCGAGCGAGTGGTATTCCGCTTACAGCAGTGAGCACCCCGAGTGGTATGATATGGGAATGGCAGGTGATTTCCCAAGGGCTGTCTAATG
CTCCGACAACATTTAATCGTCTGGTGAAGCAACTTTTTGTGGTTTACGCACAGACGCACTTTGATGACATTTTTGTCCATAGTCGTGCCGAAGAAGGTTG
GTCAGATGTTAAAAATCACATCGGTCATTTACGAGCCGTGCTCGAGTGCATGCGCACTAATAAACTGTACGCCAACGCGTCTAAATGCATTTTTGGTGCA
GGGGAGGTTTCTTTTCTAGGATGTTTCTTTGGGAAGCGCGGCCTCAGAGCGGATCCCACTAAGGTCAAGGCTATAGTGGACTGGCCGATTCCTAAGAATC
AAAAAGACTTGCGTAAGTGGACTGGCATTACCAATTAATTACACAAATACAGTGAAAATTACGCTGATATGGCTCAGCCATTAACTGATCTCCTTAAGAA
GGACACAGCTTGGCGTTGGGACAACACACATGATGACGCATTTCGGGCAATAAAGGAAAGACTCCTCCATGCTCCCATTTTTGCATTACCAAATCCTGAG
TACCCTTTTCGTGTTGTCTGCGATACATCCGATTTTGCTATAGGCAGCGCCCTATTACAAACAGATGCTGCAGACCGCGAGCGAGTTATCGCATTTGAAT
CACGTCAGCTGAAAGCTGCTGAAAAGAACTATCCAGTTCATGACCAAGAGATACTTGATATGAAATATGCGCTCGTTAAATTTAGAGTCCATCTGCTTGG
CTCCAAGTCATTCATCGTCTATACGGATCATGCGTCATTACGCACGGCAACACAGTCGCCTCACCTCTCTCAAAGAATGGCTCGGTGGCTTTCCTTCTTT
GCGGAATATAACTTCGAGGTCAAGTATAAGCCAGGCAAACAAAATGTGTTAGCAGATGCTCTCTCTCGCAGACCTGATTCTAAGCTTGCTCATGTCACGC
CTTTGTCGTCTCCAATTAAGGAGTTAATTCGTGTAGCATATCCACGGGATTCTCAGTGTGTGGCATTCTTTCAAGCCCTTGGGAGTGAAGAATACAAGGA
CTCGGACAGTCAATTATCGGCACGCTTGCGGGCCAGTCTACATCTATATTCCATCGATAATGGTCTCTTGTGATATCGCAAAGATGTAGCGGATACCGCT
CGCATTGTGCCTCACAATGAGGATTTAAAATATCGAATCCCGTTTGAGTCCCACGATACTGCCCTCAGTGGGAATTTTGGCCGGGAAAAGACTTATGGCT
TTGTGATTCAACACTACTGGTGGCCCAAACTCTACAAATGGGTGAGCACATAAGTGCGTACATTGGAAACGTGCTAGAGGGTCAAAACCTCAGCACATTC
GGCTGCGCCACTCGCCAGTTTACCTTTGCTCACGGGGTGTTGGGAGTCCATCAGTATGGATTTTGTGTTCGGGCTTCCTAAAGATAGTGACGAAAATACG
GGTACTGTGGTCTTTGTTGGCCGTTCAAGCAAGATGGCTCACTTAGCGGCAGTGCCGGATTCCATCGATGACAAAGGTACAGCTATGCTGTTTATCGATC
GTGTGTTTCTTCAAGACGGGTTGCCG