Description :
From Genome Similarity Track
Location :
Scaffold_15:274835- 279143
Sequence
4308 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGACAAGTTTGATGATGGT
TCCCAAGTTGGGTCTTTGTAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTCAGTGGTGTTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCACCGGCAACTTGATCTGGTTCTCAGCTGTCCTCAGGCAACAGTTCCTCATCGAAGTCGAGTCTGGCTTCATTAGTCGCGTCAAGTAC
CAACCGAGTGCTCGGCCGACTGTTGAATTCGTTGACAGCCTTGAGTCTCGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGATCAGGCAGTTCC
AGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGT
ACAACCACGTCCGGCTCCCAATCTCAAAAAGACATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTCCTGAAGCTTCTAGGGGGTCCGCCGAGTGTTC
GTTTCCACTTGGTTGGGGTACAGCAGCTTTTTTCAGTCGACTCAGAGCATCATTATGCTTTTTTGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTTTG
GCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTG
CCCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAAAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTGATAGCAAATACTAGCTTCTC
CGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGT
GGCCGATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTCATGAAGCGTGGGTCGCGGTCGTGCCTTATTA
ATGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGT
GAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCT
AGTACGTTGCCAGGTGAGTATCCACGAAGCTGTGGACGGCTTTTACTCGAGCTTCAATCTGGACAGGACTTCACGTGCTTCTCCACGTCTGCGTACAAGC
CGATCCAATAATAATCGGACTTAACGCGATGAAACGTTCTCACCACAACTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAAT
CATCGTTGTTGGTACTACAAGCCGCAGCTTGGTCTCTTCTTGCCAACCGTGGTCGTACCGACGATTCAATCCAAAAAAGTGAAGCACGCCGTCTTCTGAT
AACACGAACCGGTCAGCGTATTTCCAGGCATTTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCT
GCTCCTCGTCTTGTGCCACCAGTATCTGTCTGCGTCGTTCCCGCTGTATCGCTACTGGGTCAACATCTTCCGCAATGAGAAATGCCGCTGGTACAGTCTT
GTGAGGATGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCTTCATTCTGTTCTTGAGCTTTTGAGACATCCACCGAGTGT
TCATCTGCAAACCTGACGCATTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCCATATTACCATAATCACACTGTGGTGAGCTGTAATCAACCACGA
AATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTCCTCCTCGTGACGAAACATCTACCGAGTCTTCATCCGG
CTCGTAGATCATTTCCTGGATGCGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTCGATTCCAGCGCTTCAGTG
GCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGTCGCGAGTTCCTTGTGAGTATTCAGCAGCGCTA
ACAAAGTTTTATTCCTGCATGCAATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGGGTCACCGACGATGACTAAATCCTCGGCACCGTGCGCAATAGC
AGCCTTGACACCGTTTATCATTCCTGTGTACTCTGCCTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCAACTTAGGAAGG
CTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTACGGGGAAGCC
TGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGAT
GCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTGCGAACTGGACCGCGCGT
CCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACA
GCAGAAGTAACGCCAAAACTTCCTTCTCAGCTGGATGGTAGTTCATCTCGGCTTCCTTAAGCACCCGACCGAGGAACCGTACGGGGTGTAACCTGCCTTC
ATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTAGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGT
GAAACACTCGCCTTCCATTTTTCGAAAGAACGACGTGCCACAGAAAGGCCACCTTCAACAACAAAGTCTTCATCCTTAAGCTGGTACAGCGCCGCACCAT
AGACCGTGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCACTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAACGAAAGCTCGGTGATGGC
CGCAAGCTTCTTTGGATCATCCCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGACAGAAGATGCTCTTGGCAAAGCTAATG
CTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGTGTCGCCAGGCAGATGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAACGACC
GTCGACCAAACACGGGTACCAGCGATAATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTACTACAGGGTCGGTCTC
TACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTAAACCGAACCCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTC
TCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAACCCAAAGG
GCATGCGTAACCACTCAAAATGTCCTAGTGCGCAGACGAACGCTGACACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATC
CAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTG
TAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCACGCA
ATAAAGCGCGCAGCAGCTCGTACAGCTTGCCATGAAATCGCAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCA
TACCGCCCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACTAGACGTTCTCGGCGTTCAGTC
GACAGCTC