Description :
From Genome Similarity Track
Location :
Scaffold_301:27478- 37682
Transcript NameFunction/comments
Phypl_g6687hypothetical protein
Phypl_g6688hypothetical protein PHYSODRAFT_504737
Phypl_g6689hypothetical protein PHYSODRAFT_506739
Phypl_g6690hypothetical protein

Sequence
10204 bases(100 bases per row)
GAGCGCGACtactacgcgctgctgggcgtgtcgCGCGgcgcctcgagcgacgagatccgcgGGCGCTTCCTGTCGCTCTCGCGTGAGTTCCACCCGGACC
GGCGGCGCGGCAACGcgacgctggtggcggccgccaaTGCGCAGtacgccgtgctggacagGGCCTACAAGGTGCTCTGCGACCCGGTGACGCGCCGCGT
GTACGACATCTACGGCGAGAAGGTGCGTGCAAGTACAGTGGGGACCGTCCCATATTGTTGGGCGGACGAATCAATTGACAGGGGCAACTACCGTGAAGAC
CCTCTGAAGTGATAGCGGGATGGAGTATCTTTAAATTGATCCTGAAACGgtgctggttgctgcagggggtgcacgcgctggagcaggatGGCGTGGCGCG
CCAGCAGGTTGTCGGCGCGCACCTGAAGACGGCGGAAGAGATGGAGCACTACGTGGAGCAGATCATGCGCCGCATGAaccagcaggcgctggaggcgcag
tTCTCGTCCTTCAGCGAGATGTCCATGCACGTGGACGCGTCGGACTTGGTGCAGGCGCCGATGCAGGGCATGCGCAGCCTGTTCCACAGCGGCGCGCGCT
TCGTGGACCGCACGGAGATGACCATCCACCAACGCACCGCGTTCCCGCTGTCGCGCAACACGACGCTGACTCTTGGgggctacatgtacgacaAGATGGG
CATGGGCATGGGCAGCTTCACGGCGCAGTTGCAGCACACGTCCTTCGACCCGAGCATCCCGTCATTCACGCTCATGAGCGAGCTGGGCTGGACGCCGAAG
CTCCACTGTCAGATCAGCCAGCCGGTGTCCCCGCACACGGTCTTCATGCTCATTCCCGACCTCGACGACAACGGCCTGGACATCTCCATGGGAGCAAACC
AGCTCCTGTCACCGCAGCTTCACGGCGCCATGATGTGGAGTACGCGAGATGGCCTCTCTGGCTCGCTCAGCCAGGATACTGGCACGTACAATGCCacggc
cgccgtcgccgtgAATGGCGCAGGACCCAACGTGACCTTCCAGTTCCGCTGTGTCCtcatggcggcgacgacggccaaACTATCGCTGCGCGCAGGCCTT
GCAACCGGAATGTCGCTAGTGGCTGGAGCTAGCCGAGAGATTTCTAACTGCACTCGAGTGGCGCTGGGTATCTTGCTCGCGCGCACGGGAGTGACTCTGC
GCCTCGGCTTCACTCGCGGCAGTGTGCGGTTTGTGATGCCCATTTTCCTGTCGCCGTTCTCCGCGCAGTCGGCGTTCTCTACGTTTTGTGCAGCCACGTC
GCCCTTTGTGGTGGCCGCGGTCGTCACGCAGCTCGTGAAGCCTGCGCAGGAACGCAAGCGTcgtctggagctggagcaccgGCACGACATGCGTGTGCAG
TATCTCGCGGCTGCGCGTCAGGGTGcactggagcagcagaagctgatGCGTCGTTgcgcgaaggagaagatggagcaggagcagcagcgagaggaTGGTA
AGGGCTTGGTGGTCTTGCTGGCCCGGTACGGCAAGAATCCGACGAGTCCCGACTCGCGGGAGGCTCGCGGGGATGATCTGGATGTCGCTCTCCAAGCAAT
GCGGGAGCGGGATCTGAACCGTGAAGTTGGTGGCGAAGTCGAGACTGGCAGCGGCGATAGCATCACACAACAGGAGgcggacgccgagctgctggagcag
aagtGGGTCGATGTAACGATTCCTCTTCAGTTTTTCGTCAAGGTACGGGACTTGTTGCAGCCTAGCAAAAATCGTACGTGCTAACTGTGCTGGATGTATA
TTGTTTCGAACGGTGCTCAGGACGGAGAGCTTGCTCTgacttcgtcgtcgaaggcTGGGCTACTAGGATTCTACAACCCGTGCATCGGCGAAGACCAGAC
AATTGCCGACGCACGATCACTACCCAGCTCCGCTGTCAAGCCGTTGCTGTAAGTATCCTAGCTAATACTTCGTCGTCTACTGCATGCATCTCACAACCGT
ATTCCGTTGTTTTGCTATTACAGCTACGTACGATATGCGTACGATGGCCAGGTGTTTGAAGCCACTTTTGACGATGATCAGGTGGTCAGTTTGCCGTCGC
GGTACGCCCAGGTCATGGGCCCCGCCGGAAGTGTGTACTAGACTACAACTACAGACTGTACGTGGCATagagaagaaggtgcagcACGCTAGAAACTAGG
TGTCTTAGGATTGTGTGGGAATGTTTATACCTGCAATGGACGAGCTTCCACCTTCACTGACAGCATGAATTGGTCCACCAGTAGGTGCAAAGGTGTCTCT
TGAGGCTTGCTAGGTCCCTGTGCGGACTGCTTTAACGCCATGTGCTGCTTCGTGAAAAGCACAATAGCAATCGCGTCCAAGAATTCCGAGAACACGAGCT
TCGTGcccatgaagaaggcgtccGGCTCGCTGTCCTGGCTGTCCTCGCCTGAGCtacatccagcagcgacactCCGGAGAAGCTCCGACTTCAGGGGCGG
GGAGGAAGCTGCAAACGCTCGGTTCAGCGCTGAGAGGGCATCGCGGATCTGGAAATCCGTCGTAAAGACTGGTGCTTTGGCGGGAGCCTCGTTGCGGAGC
ATGACAAGCACGGATCGAATGGAAACTTCCACCTCGTGGCTCTCGTCTGTCGATGCTTGGGGCTCGTGTTCGCCAGACTCCTGCTCTGTCGTGTCATCGG
CTTGTCGACAAACGGAAGGAGCGGCACAACCGCTGTACAAACATTGAAGTTGACTGTGGTGTTTCGTGAAAATACTGTGCAGATTCTTGCCCATGAGCTC
TGCACGCAAAAGTGATAGCCACGTCGGCGAGCTTTGGCTCAGTGTTTCGTGACGCCCGCGCATCACTTGATCGTGCAGATCGGAGAGTACATCCGCGAGA
AATACGGTGCTGTCCTTGCTCCCTGACAGCTCGATCATGCCGTCCGCCTCGGCTGTCATCACCCAAGAGTGCGCGATGcgcacaagcagctcgacaaATT
CCCGGAAGAGTAACAGCTCGTCCCAAGGCAAAACTTCGAGTCTACTTGGGTCCTCAGGGTGTTTGAGGCGATTCTCCGCAGGTAGGTCGTCCAGAAAGTG
CTCAGCTATGCTCAttgaagctgcacaagcGAGAGCACTCGCTCGCTGAGCTTTTCTAACGTCGCCCATAACACTTTCGAGCTGTCCGCTTGTAAAGTAG
AAGCCGCATTGGGAAAGTAGCTGCCGACACTCGAAGATTTCGAGTAGTGTCCCGGCATCGTCAGGATCATTGGGAGCGCAAGTtgaagatcgacgagatT
CCTTGATGCACCCGCGATACAGAGAGCGCAGCTCGGTGTTGAGGCGCAGTGCGGTGTGTTCGACTGTCTTTCGGGCCTTCTCGCGCTTTGGGATATCCGT
GATCGGCAGTAGATCGTTGATGAAGAGCATGATACCAACAGTACTCgtggaagacgaagatggctgcgctggtgacagtgctgctgctactgcagGTGCA
GTAGACTCGGTCGGCGGTACAAAAGCTGTCGGAGGAGCGAGACctgcggttgctgccgtGGCGTAGGAGCCTTCGACGCTCCGGTCTTGGTGGAATAACC
CAACGAATACGCGGCCATCCTCGTAAAAGAAGAGACCGTAGCCATCTTTGACGTTTGCTTTCCACCCGCCTTCGTACCGCGCACCGTTAGCGTAGAAGAA
CACGCCGCGTCCGTGACGTAGCCCTTCGTGGAACTCCCCTTCGTACCAGTTCTTGTCGTGCGGGTTACTAGGAGCTGGAGGTCCATTTCTACAAGTTGAC
CCTGCAGTGAGCGGATTCACAAGCCACACGTGCCGGCCAAACCCGTGCTGGCAATCGTTCTCCCACTCGCCGTCGTATCTCTCCTGCGGGGTGGCGTCCT
CGGGAttcgccagctcgtccacacCGCGTAGAGCCATCCAAGTCATGACTCCGCGCCCGCACTTCACATCGTCTCTCCAGTCTCCTGCGTACACGCTGCC
ATCCGCGTAGTGCATGTGTCCTCTGCCCTCGCGCTTTCCCTCTACGAACTGCCCTTCGTAGCGAATGTTGCGTGCTGCGTCAAACACCAGTTCGCCGTAT
CCGTGAGGCAGTCCGTTCTCCCACTCGCCATCATAACGAGCATTACTCTGAGCCACCACCagggcgtcgtcgtcgtcatgaccctcgccgtcttcgctct
ggtgttcttcttgaccacGGTAGACGAAAAGCAGAGGCTTAGGTACCTTATGACCTTCCGTCCCCACGTCTTCGTGCCCTTCCTCACTCCTTGGATGCGG
CAGTACAACGCCACGGTCTCCAGTGACGAAGACCCCGTGCCCATGTCGCTTGCCACCCTTGACATCTCCGACGTACGAGCTGCCGTTGGGCCACCAGTAC
GTCCCCCGCCCCGTGATCTCGTTATGTGTGAAATCCCCCTCATAAGCCACGCTGCTCGTCTGCCACTCCATGCGTCCCGTGCCGTGCATACGGCCATGGA
CAAAGTCCCCAGCGTACGTGAAGCCCGTCTTGAACTCGAGTCTCCCTGTTCCGTGGTACACCGGCACATCACACTcagccaccagcagcatctcgccCTT
ATACGATGCCACCACATTCGCCAGCACGCGAGggtccagcggcggcgacttcgCCTCCATCCGAGCCAGTCCGTTACCGAAAATGCACATGAACCGACAc
cacttccacttcaacgtctcaacatggctacatttaATTAACCGGTTAATTAACATGATTTCAGATATCTCATGTTGCAAAAAGCCATTATTCACACAGG
TCGCGAACAGCATGGCATCGGCCTTCGCTCCCCCGTCTTCGCCGCCGTCCATGGTGCTCCCCGCTGCGCTCCCGTCCCTCTCCAGCGCGGAAGCAGCAAG
ACCGAGGCCCCGCCTAGACGTCTCCGCAACTTTATTCCACCGCAAGCGAGTGGTTCGTCGGAAAACGCACACGCACGcgggcgtctccagcagctccgtt
AAGCGGAAAAAGTTGTCTCCTGCGTCCCCCAGCCACGCTACGAGCCCGCGAGTAGCTGCAAAACTTGACGCGCCAGCCTGCGTCTCATATGCAACAGTGG
CGACGCCCTCGCCGACGCATAACGGCCGCCCCAAGCCGAATCTCCACGTGCAGACGGACTTCTCGGCGACGTAttcgccgccgtctccgtcgagtttctc
gcccgtggcgctgcttgccAGAAGTTCCCCCTACCCTTTCACAGCCAGAGGAGCAGACACCGAGCCGAAGCTGGCCCCGGCGCCCTCGCCGAGGTCTGGA
GGTGCCctgggagctgctggaggggGTGCAGCCAAACCGCCGGCCCCTCACTCGTTCCGGCTGTCGGATTTCTTCTACAAGGAGATCTTCGGCGTTCACG
ACATCAAGCAGAGCGACGGGATGCACCAGGAGCGCGTGCAGAACTTCTTCGTGGTGCCGCTGAACACGGAGCAGTTGTTCCTgttcggcgtgctgctggc
gctggacagcTTCCTGTACGTGTTCACGTACTTGCCCCTGCGGATTCTGTTCGCTTGCGGGTGCGCCGTGACGTCGAGTTTCCACACGAGGGTGTTCCGA
AGGACGCACTTTTACGACTTGATGGTGGCCGTGATCATGGCGGTGGGgacggcggtgctgggcCACGTCGACATGTCTAGAGTCTACCACGCGATTCGCG
GCCAGGCCATGATCAAGCTCTACGTGCTGTTCACGATGATCGAGATCTTCGATCGCCTGTTCTCGTCGCTTGGAcaggacgtgctggactcGCTCTACTA
TACCGCGAAATACCACCCGCGCCGCGTGACGCGCATGTTCCTGGACTTCGCGGTGGCCATCATCtacgtggtgctgcactcgctgttgctgttcgCGCAA
GTTGTCACTTTGAATGTCGCGGTCAATTCGAGCAATAcgtcgctgctcacgctgctgatTTCGAACAACTTCGCTGAGCTCAAGAGCTCCGTGTTCAAGA
AGTTCGAGGAGCAGAACCTTTTCCAgatcagctgcagcgatatcgtcgagcgcttcaagcttATGACCATTATTGGGCTTATCCTGCTGCAGTCCTCTAC
GGCGGATGTTGCCTGGGGAACGGTGCGTCGTATCTGGTGCATTGTCGTCAATCGAGTGGTGTCCTCACAGCGTACGGTGCTTTTTTGGTGTTGAGTTCGT
TCACACAGGCTATGGTTTGGGTGGCGGAGATGCTGATTGACTGGCTCAAGCACGCCTTCATCACCAAGTTCAACCAGCTTCCGCCCGCGATGTACTCGAA
GTTCATCACCATCCTGTGCCGCGACCTGACGGGGTGGAAGAGCGAGGATACGATTTTGGATCACACGCACCACGTGTCCAAGCGCCTAGGCCTCATGTCC
CTTCCCTTAGCTTGTGTCGTGCTGCGCATGGTGTCGAAGGCTTTGGCCGACGCCCCAATCGAGTTCACGTCGCCGAGCGGTATACTAGTGACGGTGGCAT
TCTTCCTCTGTTTGGCCGCGTTCAAGGCACTGCTGAGCCTGGTGCTGATGATCTACGCCTGCAAGTCGGGCCGGTTGGACGACACTCGTCCCAAGAGCCC
GCGCTCCGTTCGCCACCTGGAATCGATTCACCGCTACAAGTACTAATACTAAAGCAGCAGATTCGCGAAATTGACAATTGATAGACGCTTACTACCTCCT
TCAAAAGTTTTTCGTTCATTGTGTTATGGTCATTTCTCCTATCCATGATGTTGCCTATGTGTCGCAGCCAGAGTACGGGGCAAGATGGGCGAGCGGGCAG
GCCtagcagcttccagcttTCCATCTTTGCCTCggtcttcgtcttcaactCGGCAGCGAAGTGGGGGCTTACTGATACAGCATACTGTCGCGTCACTTGC
TTTCTCGCCTTCACGTCCACTCCGCCACACTAGGCTATTGCGCTCGATCGccgctcgccatcgccgctgATTATgggctcttcatcgtcctTGTTCTTTG
CTTTGATACAAGTCCTAAACATGCATTCCTCTTTTTGTATCTCTGTCTTATCTACAAACGCGCAAAACTTTTGGATCCTTTTCCTGCTTCTTGTCACTAG
TTTGCCTCCTCGCCTCATCATACCCacgcgtcctcctcgctggTGGCAGGTTCATCCATCCTACATATCCCAccgcacctgctgcgcgtctCCAGCCGCA
CCGGGTCTTCGTAGTTTCTCGTCGTTCATACACCACACGCTCATTCCCTAACTGCTGGTTCATACTTTTTCATCCTGGGCCCTTCGCTTCTCCATCCACG
AACAACTCTTACGCACGACTCGTCGCATTCATGCCCATGCCGCCCACATCATTCAGCATCATCATGCTGCCGTCGTTGCcgtgcatctgctgcatgcgAT
tgccacggcctcctcccTGGAAGTGGTGAGATGCGCCCATGTGACCGCCCTGCATCCCGTACAACTGCTGGTTcggctgcaggtgctgtTGGTGCATGTA
GCCGCCGCCCATAGATGAAGCCGGCAAGTGGCCCATCATCATAGAGTTGGCGCCATTATCAAACAGGTTGTCGGCAGTCGGCGACATGCCCATATCCATG
CTGATGTCCATGTTCGGGAACCGCTTGAGGATACGGGCGGTGATGCGGCGACCGCCCGACGTGTTCTTCATAGCTGCCAGGTGAGGGCGGATAGCCTTga
caagcagcagacacTGCTCCTCGGCACACACGCACAGCGCACGCTGCACCACGTAGTTGGCAAACtggtcctgcagcatcttgttCATCTTCGGGCAGCT
CGTGATCTCCGCAATGTACTTTTGGCGCACGCGCTCGGGGGCCTTCTCAAGGCACTTCTCGATCACGTTCGAGCTGAACTTCTGCACAGACAGCTCGTAG
ATGTGCCCCAGCGGCTTCATAATGACACCGAAGGCCTCCTCGGCCGTACACGAATCAAGCACATACTGCACAACGTAGTTGCCATACGGGTCCTGCATCA
GCTTCATCGCCTGGCGCTCCACTTGCTCAATCACCTCCGACTTCTGCGCCTTGTTAGCCGCGTCCAGGCAACGTTGCAGGACGCAGCATCCGTGGCGGTG
CGTTCCAACAGTCGTGCATTCCTTACACACAGCATCGAATACAAACTGGTTGTACTCGGGTTTCATAAACTGCAGAGCACGCTGAATCACGTGGTTACCG
TTCGAGTCAATACACAggcgcacggcgtcgtcctttAGTGCCTCAACGATAATGTCCGGCAGGCTCGTCGTTCGGCGTCGTTCCCCACCATCAGGGTGCT
CCTCACGATCGTTCACATAGCCGTAGTCATCTCCATCTTCCTCATCATAGTCCTCCTCAATAACGTCCGGTGACGTTGCGCACACTTCCACCACCTTCTG
CACCGACCTCGTACCGTGCAGGTtaagagcagcagccacgaggTTCGAGCTCACACGGCGGATAATCACAAGCCGCTGCTTCTCGTTCAcacgctccagc
agcttctggaagaGGTAGTTACCGAATGGGTCAACCATCATCTCGGCAAGGTGGTCGAGCGATTCCTGGTAGATCACCTCGCACAGATCGGCACGGTCTT
CGTaatcgagctgctcctgcaggaGACGGCAGCCATTCTGGTCCTTCGACATAGCGAATACACGGTTCTGAATGTCTTCCACACTCAACGCAGCGCTCAA
ACTCGACGGGTCGTTCGCAGAGCCGCCAATTATCGGTGCGCTCATGCCACCACCGTTCATCAAGCCCAAACCCATGCCACTGGCTCCAGAGTTTTCCGAG
CGGTAGCCCATCCGAGACTGCTGGCGTCCTCCAAACCCTCCATtgagctggtggccaagatcGTCTCCACCCATttgatggcgctgctgttgcatcATGT
GAGACGGAGGGGGCGACATCATCATCCGGCTCTGCTGGTACATCATCGAAGCGTTCTGACGGTTGGAGCTGTGGCCGCCACCCATGTGCTCCGGGGTCGG
AGCACCAGTCTGATGCACAAACTTGCACTTGCTACCCATGCGGCAATGGCCTTGCAGGAAAAACTTGCACTGCTTCATTCCCATCTGCATGCCCATGCCC
ATGCCCTTGCGCGGCGAGTGCGGGGGGGACGACTCCgggagcggcggcgtcatgcGTGAATACATGTTACGTCCCTGCGCACGGCTGTTCGTGTGGCCCC
CGCCACGCATTCCCATggccacttgctgctgcgaagcgtATCCCATCTGCGCGTGCGGGTGCCTCATCGGACTCGAGCGCGGGTTCATGTACATGTTGTT
TCCACCGCCGTCATACATGCCGGTAGGCGGGTGCGGCCCCACAACCATTGGGTTCCAATGACCAGAAGCCATCTGCGCCCGAGACGGAGTGTTACCATAG
CCGTACGACCCGTTAGCAGTCTGCGGCGATCggtattgctgctgctgttgctgttgctgctggcgatactgctgctgctccagggCGTACGAGGCTGGCA
CTTGGTTGTTGCCATAGTAGTCGTGCATCTGCTCCTGGTACAAGGCGTTGTTGTCACCGTCTTGGCTGCCCGACCAGGACTCTTCGGACGACATCCGCGG
ACTCAGCGTGTACGCTCCGCTGTATCCAGCGCTGGTGGGGGCACTGCTGGCCCCTGGCACCGTGCTTGAACGCGAGAGAGACAGCGAGGTCGGCATatgc
ggctgctgcgtgtcACGGCCACCGGACCGGTagcgctcctgctgctgctgagcggcagacgacggctgctggtgacgGTACCGCCCAGCGAGCGAGCCGT
ACTCGTTGGGCGACTCCTGCACCGAGTTGAGCTGGAACTGGCCCGTCGCGTACGAATTGGCACTGGCGGCAGCACTCGCGCTGCCCGAGacgccgttgcc
gccgttAGGAGCGCGCTCGTTCGTTTGGAGACTCATCTGCCGGTCGTCCAGACTGAGCTTGAGGAAATCCCCGCCCAGCGCCTGGCTGGGCGACTGCGAG
AGGAACATCTCGATGCTGTTTTTGCGCCGACTATTgtgcgacggcagcatctccacgGGCGGGCGGGCCTTGCGCACCTTGATGTCGATCGGTCTCTCGC
TCGGTCCTTGAGTCGTCGTCTCCGGGGCGGCGCTCGCGTCCTCCCGGACGTGCGTCGTTTGGTTCGACGGGGACAGCGCACGGGGCGGTAACgcgtcgtt
gttg