Description :
From Genome Similarity Track
Location :
contig_179:27475- 28574
Transcript NameFunction/comments
g13457.t1XP_009516631.1 hypothetical protein PHYSODRAFT_344027 [Phytophthora sojae

Sequence
1099 bases(100 bases per row)
CCAGCTCGGCCTTGTTGTCGTATAACGGCAGTTCCACACGGTTGAAGCACGTGTGCACCTTGGGGAAGCCGCGAGTTTGCCCAGGCAACGGCCGCAACGA
GAAGGGGCAAATGCGGCCGTCATAACTGGTTAACCCCTTGAAGCCCTGCACTGGCACGCGCGATGAGCCCGTGGAGAACTGCAGGAATCGTGCACGTTCG
TCCTCCGTGAACGCCTGAAGTACTTCCCAGAACCAGCCAACGACGTACGGGGCCTCGTCGAAACTGGGAGCGACCACGGTGTTGCGCTTCCAGTCGGCGA
GGTCGATCTCGGGAAGTCCGCACAGCACGAGCTCAAGCTCCTGGTAGTCGAAGACCAGCAGCGCTTCCTGTGGGACGACCTCAAACAATCCAAGAGACAG
AGCTTGCAACTGCGGCCCGTAGCGATCGAGCATGAGGTAGCGCAGCTTGAGGTGCAGGAACTCTTGTTTGTTGGCGTCCGTCACGGGCTTGTCCCGTCCA
TCAGACACCAAGTCCACAGTCACGACTTCGTCATCCGCTCGTAGCTCCGTGACGGAGAACGTGAGCTCCAGGGCGTCCACGCCGTCATTGTCTCGGATCC
AGATCATGCTCGTGTACACCTCCGGGTCCACGTACTGCAGGTCCGAGAAAGTGATTGGCGTGCCTAGGAAGTGCTTGAGAATGGGCAGACACAGCCGCGC
CTGCATGGTCTGTCCTTCCAGCAGGGCGCGGCCTAGCAGTCTGCCAATGCCCCGGAAGTAGAGCAAGTGGTCGGCCGTGCAGTCTTCAGAGTGCGGGTTA
ATAGCCACGGCCTGCGTGTGTCGGTGGCACGACATAAAGAGCCCCAGCTCATCGTCCAGCAACCTGCCGAACAAGATGGAGAACCATTCTCGCTGCAGAC
CTCCGGCGTCGATACCTGCTTCCCCGACGAACTCGATGCGAAGCGGGAAGTGAATGTGCTCGGGCTGAATGCCCAGCAACTGCTCCATGCTCTCCACGAG
AATGTGTTCTCTCTGCACGCGCAGCTTGATGCGTCCTTCTTCCCACGGCCTCAGCAGCGCGCCCATGCGTTCCAAGAACCACGCGTACTTCTTGGGGAA