Description :
From Genome Similarity Track
Location :
Scaffold_66:274664- 277709
Transcript NameFunction/comments
Phyra_71986HECT E3 ubiquitin ligase, putative

Sequence
3045 bases(100 bases per row)
TTTGGTCGATACAACATCAGTCAGTGGTGAAGCCGTACACCTCGGTCTCCAGCACCGCGTACAGCACAGCCTTCAACTCGTCGCGAACAACGTGCAGTGG
CAGGTCCAAACGATTGAAACAAGCGTGGCTGTGAATGAACCCGTCACCAATCAGCGACACGGCCTTCAGTGTAAACGGGCACAGACGACCATCGTAGCTC
GTCAACGCACTGAACCCTCCGAGAGGAACGCGCGATGAACCAGTTGAAAACTGCAGCAGCCGACGACGATACTCATTTGGCATCTCTCGCACTAGCTCCC
AGAACCACTTGAGTGAGCGGTGGTGGTGAAGGTCTTCCGAATACTTTGTGTTGCGCTCCCAGTCATCTACGTCGATCTCGTCGGAGCCGCACAGCAGGAA
GTCGAACTCTTCCGGGTCGAATAGCAGGAGAAGTTCGCGAGGGACGATTTCGTACAGGCCCTGCAAGAAGACTTGCAGTTGAGGGGCCACACTTTCCACA
AGCAGGTATTGCCACTTGAGCTCCACGAACTCGCGCTTGTTGGAATCGGTGACGGGAATGGCACTGCCGCCAGGCACGAGCTCGATATCGCGATAGCTAT
CTCCATCCTTGGTAGTCACGGTGAAATCGAGATCTAGCGCATCGACATTGTCGTTCTCCAGTAACCAACGCAAATTGCTGTACACCTCTGGGTCCAAGTC
CTCCAAATCTTCAAAACTTAACGGGTAGCCCAGGATCAGCTTCAAAAACGGCGAGGCCAAGTGGAAGCACAGCATAGAGCCCTCCAGGAGTGCACGTCCC
AAGAGACGACCAGCCGCGAAGAGATTTAGCAGCTGGTTAGGAAGTAGTTCCATATCCGAGCAGGGGCTCATGTAGTATGTCTGATCACGCTTGTTAGCAC
AAACAAAGAGCCCACGTACTGGATCCACAAGCGCCTCATTGAGCATCACAAACCACTCACGTTGAAGACCCCCAGCGTCCACACCGTTCTCATCGAGGAA
GTTTATGCGCACTACAGAACGAGCATTCTGGAGCGGGATGATAGCGAGGGACTCCATCGAGTCTTTGAACACGCTGGCACGCTCAACGTTGAGCCGTAGA
TGCTCTCTTTCAGCTGGAACCAGTAGGGCTGAAGCAGCCATGACGAAATGTGCATACTTGGAGGGAAAATCTTTACTAGCGAGCGCCATTGCCAGGGGTG
GTGGTGATGCATTGCCTAGGACAGTATCGGTTCCCAATGCTGTACGAATTGGACTGTTCGGCAGAGTGAGAGGAAGTCTTGTGGCATCCATATCAGCGTC
AGCTGCTGATGTGAACACAGAGTGCATCTCCTGTGCGTAGTTTACCAAGCTTGCAGCGCACTCCGCAACCGATCTGACCATAGGTCTTGGCGACATTGCT
CGATTTGCCGCATATTCTTTGTTTCCCTCGGTGTGTTCTAGTTCGGGATCTGGTTCTGAGCTACTCCGGCTCGTTGAAGCATGAGCTTCAGGTGATTTTC
CGTCCACGGCAATTCGACTGTTTGCAGGCTTGAACTCAACAACAAAGCCTGTTGCAGGTGTATCAGCCCCAACATTGTGGCTGTCACGAAACCAATATGG
GCGTCCTTCGACATCAAGTTTGCGTGTCCACTCCTTGCGTCTCTGTGCCCGTACACGGCGGCGAGTGGCTTGCTTCGAGGATATCGAAAGTGCAGTGGAC
GAGGTCGTCTGCGTTCCCGTATGTCGCTTGAAAGTCGACAACATTCTCGTCAACCTTCTCCTCTCGCCCTTGTTGCGCGACGGCGAGCGGCACGAGAAAG
GTGCCTTCTCCACAATCGGCTCGCCACAAAGCGTGCAAAAGCGGACACGCTTGAAGTTCTCAAACGCACAGAAGTCGCACACGATGAACCCTTCCTCCGC
ATCTCTTCACACACAATATAGCGTCAGCTCTGCCAGCCTCCCTTTAATTGAACGGAGACAAACCTTAGTGCCGCATCCAGACGTCGATCATCGGAGCTGC
ACCCAACCAAATGGACAGCAGATAGCCGTTAGATACAGCAACCACACGCAGAATACCCGGACGAAAGCAGATAGCCTCTAGCCTCCGTTATGGTCAACTG
CATGTGCACGTACTCGATGAGTGGCGTATTCAGCTCCACCTCGCGCTCGAACTTCTTGAACGAACGTCGTGCCAGCCACGCGAAGAAGAGTGCGAAGAGC
AGGGCGATCCCACACGCCACACCGATGGTCACGCCCACAGACATCACTCGGTGGCGTCCTTGAGAAGGGCGAGAAGTTGGAGAGTGTCAGTGACACTGTG
TCACGCTGGAACAGGTGCATTGCACACTTCGATCAGATGCCGATCAAAATTATGATGAAACACAGAAGTGTTCACCTTACACAGTGAATTAGTGGGGTAC
AAATTGATTTGTGGTTTTACAGTAGAAGGTATCGAATCAAAGTTTTCAGACCGCGTCAGTTTGCGGTTGTGGCTGTTGTGTACAGTGACAGAAATCTCCA
AAGCAAAATGCACTGGCGAAAAGGTCCCTTACGTGTAGCCAACGCACTATTTAACCGGTTGAAGCACGCGTGACTGTCGATGTACTTATCGCCCTCTCAG
CGAAAATGCACACAGCCATCTATCGTAGTGCACCGCAGCCACCGAGCGGTATCCACAGGACGAACCCATTGAAAACTGCAGCAATCGGCGTCATACTCGT
TGGGTATTCCACGCGCCAGCTCACAGAGCAGCGACGTGGTGCAACAAGTTCGAGTAGTCGTTCACGTCGAGCCACACAGCGGAAGTCAAATTCTTCCGGG
TCCAAGCAAGTCGCGAGGAATGATTTCGTACATTCCACGAAGAAGACGTGACGCTTCCTCGAGTAAGTACTGCCACTTGCGCTCCATGTATTGTTGGACT
TCGGGACGAGCTGGTCTCCTTTGTATCTACGTTCTCCAGCCGCCGACACAAATTGCGATAAACCTCGGGGTCGTAAGTCTTCCTGATCGGCAAAGCTGAG
GGGGTAGCCCAAAACCAGCTTCAGTACAGGCGATTCTAAGTGAAA