Description :
From Genome Similarity Track
Location :
Scaffold_283:27458- 28951
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_283-snap-gene-0.27B-box zinc finger domain-containing protein

Sequence
1493 bases(100 bases per row)
GTCAGTTGTTCGGTCGACAGCACGTGCAGCTCGCCAACGAGCTCAACGTCCGGCTTGACTTGGTCGGCGCCACGCACGCCGCTGTCGAGTGGAGGAAAGT
CGTGTTGATCAGCGCGAAGCAGCTTGTGCTGGCTCCAGGCGGCCAGGAACTCGACAGGAGATAGCGCGGCGCGATGGTCTTCCAAGCTCTCGTCGACCCA
GTCGATTTGCTGCGCCTGGCGCTCAAACTCCAAGATCTCGCTCGTGATCGTTGCCGTTCTGGACGCAATGGCGTCGGTCAGCTGGTCCATCGCCCGTCGG
TATTGCGCCTCGATCGCTTCTTGAACTTGCCGCCTGTTCTGCTCGACTTTCTCCTCCAGTGCTCGGAGTGCTCGCAGCTTGCTGTCAATGAGTGATCGAC
GAGATTCCAGCAATGGATCAGGTTTGAGCGTCTCGCGGAGACAGGCTTCGTAGGCGTCAGCGATCGTCAGCAGGCGATGCGCGCCATTGTCCCCGACCGA
GTGATCCCCCACCATTTTGCAGTTGACGCAGATGGGGACATCGCACACGGGACAGAAGAACTCGACGGGCTTCTCGGTGTGGCTTCGGCACATTGGGAGT
CCATCATCCCCACGAGCGAGGCCGTTCGAAAGTAGATTGGCAAACACGTGATCAGTTTGGTCCCCATTGACAGACAAATCTTGGCTGATCGCTGGTGTGG
ATCTCCCTGATTCTTCGTCGAGCTGGATACCGTTCGGTTCGCGCGTCTTCGCGGCACTGTGGCGGCGTCCACGTCCACAGCTGTCACTAGAACTGGTCTG
CCGATCTTGCATGCTTGTATCTACTGGCGTTCGTGAGTGGCGACTCGCGATTTTGTTGGCCGAATGAACTTGATCGTCGCACGCCTCGCACAAATTGGCA
GAGCAGGCTTTGCATACAATCACGGCGGTCTGTTTCTCACAAAGTCCGCATGTCCCTGACTTGTCGGCGTCGATCGGCACGGTTGAGAACCGCACGAGGT
ACTGTGGCAGCACCTGGAGCGGGTTGGTCAATATGTACTCGTGGTAGTAGCCACGTTCGAGCGCAACGCGATGTCCTTCTCCATCCTCATGATGTTCTTC
TCGACCATTCTCAATCACCTCGTCTTCCTGGAGATAGTAGCTGTGGTAGCCGGACGGAAGCTTTTCGTGCGCTTCATCCTCGCGATGAATCACGACAGAC
CTCCCGACTGCGATCTTGCACAGCACAAGCTGTCGCGTGCGATTTGGTCGTCCGCCTCGGTCGAGATGCAAGTTGCCGGTCGTGAATTTCATACCGGCCG
TGTGTTCGCCAAGACTCGTGAAGCCGAACGAATGCATGTCGGCCAAGTTGGCCCCCAAGTCGTTCACGGCCACCCACGAGTCGAGTTCAAGTAGTCCCTT
GGCATGTTGAGCGTATTGCGCGACCAATGCTGGGTTCTGCATATCCCACACCATCAAGCTGCCTCGAAGTTGCACTCCGGGCAAACAGCACTG