Description :
From Genome Similarity Track
Location :
Scaffold_36:27453- 29062
Transcript NameFunction/comments
Phyta_totarag1751conserved hypothetical protein

Sequence
1609 bases(100 bases per row)
GCCATGGACCTTACGgcggaagacgacgacctgCTGAGTTACTTCCTGTCGGCCGATGTGGCGGCGGAGCAGCCACCGCAGACGCGTCCGGGTGCGACCG
ACGCCGGAGCAAATGTTGTCGCCACGGCAGAGCAGTTCACGCTGGGCCAAACAGTCCCTCTAGCGTCGGAGCGGACGTTCGGCAGCGAATTGGCGCCGAC
CACGACGCCCGCTAGCAGTGGCCCTTCCTTCCAACAgacgcagagcagcttcacagAGAGCTCCATGATGCGGCCGGccgccaacgacgacgacgactcg
tcCAACACGGGCGCGCTggacacggacgagaagcggcagcgacgactggCCAGGAATCGCGAGTCGGCGCGTCAGAGTCGCCGccgcaagaagcagtacC
TGGAGCTGCTAGAGGAGAAGGTGCGTGCATGCTACGCTGTGAGTGGGGGGTAAGGAGTTAGAGGGGCCGACGTTTTTTGTGATGTGGTGCAGGTTTCTCA
ATTAACTGAGAGCATTGACACGACGCGCGCGACGCATTTGGAGCGTGCAGATGAGGTGCTGAACCAAGTGCGATCGGACATTTTGAAGAGCCTCGCGGTA
GACAGAAAGAATGGCGGCTCGGAGGAGGTACAGTGATTTGTGCTATGGTTTTCAGGGGTTTAAACGATGATTTAATGATGACCTGCGTGATTTTTACTTT
GTGTGTATGAAGTCTGTGCAGGAGAAGATTCGACAGGGTATTATGCTGGTCCAGGAGCGGTTTGGACCGAACAGTGTCGTAAGTAGACGTTGTGTGCGGC
ATGCTATTGCATCCAATGTGCACTAATTAGTAACCCTCTCTTGTTTGCTATGTCACTTTTGTAGGAGCGATTAGCTGTGAAGGACTACAACTTCCGTCAA
CTTGACAACCTGCTGCTACCTCCGTACTGCCGATTCCTGCTGTGGCTCAGTATCCAGGACGAATCGTTCTTCGACGAAGCGAACGGAATGGGGGCAAAGA
ACGCTGGAGACGTaccggagaagaagaaagcccCCGTTatggtgaagaaggacatgCTCTGGTCAACCCTGACGAGTGACCTCGCTCTTACCTACGAGCA
GGAtgagaagctgaagtcgtTGTACAAGTAAGTTCCACTCAGTCGAAGCCACCAGTTATCATTGTGTATTGGTACTGATACGTGTACGCTGTGCTCATTC
TGCAGGTCAGGTGACTCTAAGAGCAGTAAATCAGAACGTCGACGGGTGGCAATGGCTGTGGTGCGTATTGAATTGGAATTGTGGTTTCCTCGTTGGCTTA
GTGCTCACTTTATCGTGTATGGCATGTATTTTGTCGACAGACCTATTTaagcaagctgaagaaatgCCTCGAGCAGCGCTCAGAGGCGGTTCAACGACAA
ACGGAAATGCTGCACTCCATTCTGACGCCAGAGCAGTCACTCACATATCTGCGGTGGGTGGACGCCAACCAGGACCGACTGCCGAACTTCGTGGATAAGA
CGCTGTCGGTGCCGAACACAGGTGCTTCTGATGCGGTGCGAGCCATTCTAAGGAAAGACGATCGTGATCTCACGGTGGAGGACGTGACTGCGCTACTCGG
AGAACTGTA