Description :
From Genome Similarity Track
Location :
Scaffold_5:27450- 28884
Transcript NameFunction/comments
Hyaar_Emoy2800965hypothetical protein

Sequence
1434 bases(100 bases per row)
GACTTGAGTTCTAGCATGGCGTTGCCGCCGTCCATCATACCCGAGTACGATTGGTTCATTTCTCTTCTCCTATCGCCAGTGCATATCCGTTCGATGCTTC
CGTGGCGTCCGGATAGCTCTCGAACGAGTAAACCACCTCGTCGTGGGATTTAGACGTGGCGTCAAACCACTCATCTATGCTGTTTATCTCTTGCCGAGTC
GAATCAGAAACAGGTCTATAGAAATACGAACTTACAAAATACGTTGCATTCGTGTGGCATCTTTTCACGAAATGACGATGAATGCGCTGCTGGGAGAACT
GCACATGGTAAAGGTGCTGCATCAGCATTCGGGCGTGTGTCCGTTCGCACACCAGTGGAAGTATAATCCACAAGCACATGCGAAGGTGTCGACGCGCTTG
TCATGTCAGTTAAGCAGTTCGCGCACGAGATTGGAGGTGGAGGTGCGGACCGTGATCGGTGTATACGTCGTGCATGTATACGCTCTCGAACTGTATGCTG
TAATTAAGGGTCTAGAGGTCGTCCAAGTGCACTTTGACCCGAGTCAAACCGACAACAAGGACCGACAGGGCCCTATCAGCTTCATGCCAGTAAATACGTG
ATAAACGTTTCAAAAGTCGAACTGACATGCTAATCTGGTCATATGGAGACCTCTTCTGGCGGTCATGTCATGAATTCGCTCCAGAGCAATACCATTCAGG
CTGTAATGTTTTACGAACGAACTGGTGAGGCTGCAAGTGAAGCACTTATAGAGTTTCTACTGCGAATTTTGCAACGGTTTGGAGAATCGTATAAAAAGTG
CTGATGCAATTAAAGCCGCAGATACAGGCGAGTGCGATGCCCACGCCAAAAGAGGTCGGTGTTGATACCGGAACAACAATATGGACACACATATGCATTT
TTTGCATCATTTTTGTGGCTTTGTTGTACGTACCCTATAGCGCGAAGCCATTGAAGCCCCGTTTTGTAGATATGAAGCTGAGCTCGATAGTCAATAGCTG
CTGCATTTAAGTGGTGACCTCGGTATACAATGAGATGCTGCCGCGATGCACCGGGGTCTTGTTCGGGTCTGTTGTACAGTATGGATTTATGTGTCGAGGC
TATTCGACACCGAGATCCAAGCTTTCACTGAAGTCAACTCGAAAATAAATATCACTGCTGTTAGTGATTTGGAAGTATCTTCATTACCGCTATAAATACT
GCGTACTAGGAATCTGCCTGCTCCCGTGAGTTTATAAGATGTATCGTTGTCATGCTTTAGCCTGCACAGCTTAAATAGTCCCTGTTGTTGCTGCTGCTAG
CCAACGCACTTGTTCGTCTTCGATCATCGAGTCCATTACGCTTGTCTCCGAATGCCAAACCCCATAGCTCCAGTTGGACACAACAAATCTTCTGCGAAGT
GGTTAATGGAGATGAATCGAACATTTCGCACGTA