Description :
From Genome Similarity Track
Location :
Scaffold_1400:2745- 3810
Transcript NameFunction/comments
g16879.t1hypothetical protein

Sequence
1065 bases(100 bases per row)
TGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATAGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCGCAGACG
CGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCTCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATG
TTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGTCCAGTCATGCGAT
CCGCTACGGCTTTGTTGATATGATGGATTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTATTCGTCCGTTGCGACTTCCGAATTGTTGAT
CTCGGAGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATTGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGACGGGGTTGTTGATG
AGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCAGATCGTTGTTTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCA
TTTCTGCAGCACTATCAGAGGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCA
TGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACCGGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCACGTATGGGAATGAAAAGAAACGT
TGTTGAAAGGCGGTTTATTTTGTCCAATCAGCAGCGATTTCATTCGGCTACTTCCGATGTGATGTAGTCCACTCTACGCATCATAATAGCCAATCGCGCA
GAAGTTCCACTATATAGCCAATGAGAGGGCTCGAATTATAGTATTGGCGAATGGGAGGGCCGCCTTCGCTGCGCTATTTATAGCCAACGAAAAGTCCGGA
TTTGCGTTACGCTCGAGGTGCGTACGGAATGACGGACAGACGGACGGACGGACGGACGGACGGAC