Description :
From Genome Similarity Track
Location :
Scaffold_1:2744834- 2752194
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00715hypothetical protein
Phypa_INRA-310PPTG_00716hypothetical protein
Phypa_INRA-310PPTG_00717hypothetical protein

Sequence
7360 bases(100 bases per row)
CCTGTTTGTTCCTATGACTGCTGGTACTGTCCAGTCCAGCCTGTTCCTACCACGCGACTAACTCACTAGCTCGTCACTGCTTACTGCATCACTTAGCTCC
CCACGGAGTAGTTCAGCAGCGACGGATCAATCTTTTGGCCCTTCGAGCGGCGTTTACCCCGCTTGTTCGACGACCCCGTCTCGGACGCACGCTGTTGGGC
GTCCAGGTGGCCCGGCGACTTCTTGCCGCTGTGTTGGGTCTTCTTACGCTGGATAAACTCCGTGGCGAAAGCGGACACACGGGGCGTCGATCCCAAATAC
GCCGCAAGATACTCGCGGACCTCACCAGGGTCCTCTACTGTGGCGCAGTATTCCAGCAACGTCACATCCGCGTTGCTGTCAATAGTTTTCAGTTGCTTCA
GAGCCCACGTCATGAACTCCGACGACACATTCTTTGAGCCGAAAGCATTCGAAGTGCCCACTTGAGCACTGGTGGATGTAGACTCCTTCTGTGCTGCTCC
AAAGTTCCAAAATGATGCGTCGCTCTCGGTCTTCGGCGGCGAAGGTTTCGCGGCTCCATTGGCAGCACGAATTTGCTGACGGCTCTTTAGCACGGACGCC
GGAACAGGACCCAATACTGACCGGGATGGCTTGGGGATGGCTGCTGCAGCGACCTTGTTGCCCGCCACGATATTCATCCAGTGCGAGTTGGTCGGTGTAT
TCTCACTGGCTTTAGCCCGCTCCTGTGCCAGACGCTCCTCTTCAGCCAAAATATCGCGCATTGACTTGGAGGCGCTGCTTTTCGTCACTACAGCAGGTGT
GCCCCACGGACTTGCTGCTGGTGCTGCAGGAGCAGGAGCTGGTGCGGCCTTGGTTGTCGGGACTTGAGCGGGGGGCGATGGTGCAGGGGGCGAAGGAGCG
TTCGGTGCCACAGCCGTCGAGTCTACGCCCAGCATCATCTTGAGTTGTGCTCCCATTTGCGCGAGATTTGCGTTGTCGCCCTTGTCAGCACTCATCTTGT
TGAGCATTTCACGCTGCTCCTCCTGTTGAATATCCTTGAGCGACTTCGAGTTATCAGTCGACGCCTTAGTAGCCCATGCATTGGTCTCAGTCTTGACACT
CTTGCCATTCTTTTTAGACTGACTCGCAACCGTCTCCTTCTCAGCCTTCCGTTCCTTCTGAGGCGATTTGATAGGAGATGCGGCCTTGAGTTGTTCTTGC
TGCATATCGGTCTGGTCGTCTTTTTTGCGAACTTCGTTGGCAACACGACGTTTCTCCTCGTTCTGAATGTCGAACAGTGTTGGTGACGGACGGTCCGGGG
ACTTTGGTCTAGCTCCCCACGCATCAACCACGGGGGCGGCAGCTGGGCTCTTCGGTGCAGGAGGCTCAGTAGATTCCGGCGCCACTGGACTCAACGGCCG
TGCTGACTGCAATTCGCCCACAGCGCTTGCTGGGTTTTCTAAACCAGACATTTCCGGAGCTGCATTCGGCCAGAATGCCTGGTCACGTCTCTGTACTTCA
TCATTCAGGAACATTGAGCCTTGAGGTTGAGTATTCTGTATGTTCAGCTGGTGTTGAGTGCGGTAGTCGGACTGGAATTGAATCTGCATACCGTCCGATC
TGAAGTTGTCGTTTGTTCCCATGTTGGCGTCTTGGTTCCCTCCAAATATGCCTAATGCGCTCATAATACCTTCGCGCTGGCTACGCTGCCACGAACTTTG
TTGCAGTAGCATTTGCTGTTGGTGTTGTTGCTGCTGACGCTGCTGCTCTTGTTGATGTTGCAGCATCTGCTGCTGCTGATACACTTGCGTTTGCTGCTGT
TGACGGGCGATTTCAAGACGTTGCATCTCCATTCGAATCTTCTCTTCCTGGTTCAGCTGCATCATCCGCTGCTGTTGTTGTTGTCTCTGAAGCTCCATCA
TTTGCTGTTGTTGCTGCTGCTGTTGGCGCTGTTGTTCACGCTGCATTTCCAATAGACGCTGCTGCTCATTCTGACGAGGATCAACGTGCATTCCTCCAAT
ATCACTCATACGCGACGGTGGGGCAGCGAAAGGCATTTGTCCGTGGACGAATTGGTTCGCCAAGGGAGTGAAAATTCCCTCGCGACCGAAACGAATCGGT
AGATGAGGCTTAAAGTACCCAGCCTCGAACCATTCCCGCATCTCTGCTGTTTTAAACGGACCCTGCTGTAATCCCTGCGGGTCCAGATAAAACCATTCGT
CCTCCACTTCCAGTCGTAGCGACGATAAGCCGCCGAAACCTTCATCCACCGGCATTTGAGACAGAGAGAAGCTACTCTTCTCCTCAAGCACAAGCTGTTC
GCCTGCAGGCTCCAGCGCATCGAACAGATGGCTCCCACTAGACTGACGACCCAGCAGATTCGACTCGCGATCTTCCAATGGATCATTAGCTGTGCTAGAA
TTGAGCTGCTCATCAGGAGCAGGATCATCCCATTGTACTTCTTCGTTATCACTGTCATCAAATTGTCCAGCAGCCGCAGCATCCTCTAGTTTCTTGTCGA
AAGCATCCAAATCGTCCTTAATCTCGTCCTAATAAACCAACATGTCATCAGTTATCCGAGTGCACCAGGTTTCTGACGCTGGCTTGAGCCTTACCGGATC
GATCTTCGGTCCCTGGAGCTCCTCTCGCATCGCATCCATCTCTCGTCGGAATTTCTCCGCCGCCTCCGCCATACTTGACAGGTCCTGCATTCCACATAAC
AATAACATCAGCCATCCAGCCGTCTAGATATCATCGTTCCATAAGTCGATACCATTTCATTGCTATCCGCTCCTGGCTCCAGAACATCATCCCATACATC
GTCTCCGTGCGATCCTTCCGTGATCTTGGCACCACGCTCCCACGTCGAGTCTCTTTCGTTGTGTCGCTGTTCATCTCTCTGCTTGGCTCCCTCCGTGTCG
TCCCCTCGAGATCCTCGTTCCTGTTGTCCACGTGTGCCCTGTTGGCCTCCAGACGGTGCGTTGCCACGACCGCGTCCACGGCCACGATTGCGGTTGAGTG
ACCACTGCTTGTAGATCTCCTCGTAGTCGAAGGGAAGCGTGCTGACGGGTGGTAGACTGTGTTCCGAGGCTACTGTGGTCTCGGGAGGGAATTTGGGCGC
CTCGGTGGTTGTGAAATGCAGCGCCAGTAGCTCTTCCTTAGTGTATCGCAGCACTTTACTCTTGCGGCGCTCTCCCCGGTGATCATCGCTCTGTCCGCCT
CCTGTGGCCGCGTCTTTAAAGGACGTGGGGCCGCCCGAGGACGCCGACACGAAACCCTCGCCATCCTTGGACCATTGCGGACGGTAGGCGGATCCCTCGG
ACTCAGTACGGCCACGGCCTTTCATGGCAAACATCGTACGCGGCCGCAGCGAGATGTTACTATTGCTGCTACTGCTGGCGCCGTTGCTGGCCGTAGGGGG
TTTCTTGTTGGCTGTGTCACCGAGGGCAGCAGGCTGCTGTTGCTTCTTGCGGTGCTTGGTGGTTATGGTGACAAAGTCGTCGTCATTACTAGGGCTGCTC
ATGGCGGCGGCCGGCGATAAGGTGCTCGGTGGCTGTTGCTCTTGGTGTTGGTGGTTGCTCCTTCTTTGGGTGTGGGGGAGCGGTGCTGCTGTGGCCTTCA
ATTAGATACGATTTTTTTAGGGAAAGATTTGATCCAGTTTGTGATTAATGTTTTATGCTTTTGTGACCGGATCATCAATAAGCAATGAGCTCTGAGGGGC
TGCGGAACTGGCGGTGCGTTGTCTGCCAACTTCATGTGCTGACGTATGTGTGCGATATTGCTTGATTGATATTCGCGTGCGTGTGTTGATTGCAGCGGCG
AGATCATCCAGTCCAAAGCGACGACGACCGCTAGCTCTGAGAGTGTTGCGAACAAAGGATCTTCGCCTGCTCACGGATCTAAGTCGGACCCGTCCTCGCC
TCCTTCGGATGATCGACATCCGGCTCAAAAGAAGGTGCTTCGCAAGGACGAGTTCGGTCGCGATGTAGAAGTTGTAGTCGACGAAAAGAGTCGCAAGAGA
TCCAAGGTCGAGCGGAAAGAGGACAGGAAGAAGGAGCGGAAACACAAGCACAAACACAAAAAGAAGCACAAACACCATCGAGACAAGAGTAGTGATAGGT
CGAGATCGTCGAGCCCTCGGGGTCGGCTTGTTGGCACGCCGCCGCCGGCAGATCCGTTCCGTCCACAGGTACGCTTGGTTGGAGTGCATTAATGTCGTGC
AAGACGCTGACTGCTGTTGATGCGTATTCCTGGTAGCTGGACGAAGATCGAGGCAGACGTCTACACCGCCGCACCCATCACAGAAATCGGACCCGAAGCC
GTAGCATACCCAGGAAGGGTTATTCGCGCCGCCACAGCCGAAGCCGAAGCCGTGGAGACGACAGTCCCACTCGTTGGAGCTCCTCCCGAAGTCGTAGCAG
GAGTCGAGGGCGGCACCGTAGTCCGAGTTCTCCACCTTCTAGATCGCATCACAGGCATTCATTGGCCTCAGTGGAGCGCAAATGGACTCACAACGCTTTC
GACGATCGCAGTCCAAGTCCACCCCGACGAGTTGATCCACTCTATCGACCGGAACCTGAAACTTGGGTTTCACGAGCAGGAGGCGTGTACTTACCTCGCA
AATAGCATCACTATACCGGGAAACGTCGTATCACGTTTTATCTGGTTGACAAATGAGCACGCTTCTCCATGACTGGGATGAAGGTGTGTAAGCACAACTA
TTGCTCGTGGTCGGCTTGGAATGATACGATCATCCTCATATCTTTTGCTCACGCATCCACTGACTTCTGTTTATAGGCTCTAAAAGTAAACGCAAGAAGC
TCCTCGAATGGTTTTGCAGCAATTTTGATCCTACACAGAATGGTGGTGGACAGCTCGAGAGCGAATACGGCGCAGACATCGCTCTCTTTCTGCCACGTCT
CCTGTCGTGGATGCATAAAACAGTAGCAAGCGCCATGTGCACCAGCAACGATACCTGCAATGCCACGAGTAAGCCAGGAAAAGTAAAGTGTTTTGCGCTG
ACGGAGCAAGTGGCTTGCCTTCACGTTGTCTTCGGGTCAGCAAACGCGCACGAATACTATCGAGAGTTCCAACATGCTGACGGTCTTCAGTTGGTGTTGA
AAATTGTGGCCATCTACGGGACTGCCCCTCATTCCCAAACACCTCTTGTGTCGGTCACCGACCGAGAAACGTTGTTTCGCATCATCCTGCGGATCTCCAA
GATGAGTCGGCAATGCAAGGAGGACATTAGTTGTCTTGATGGCGAACTAGCTGTGATTCGCGGGGTTTTGGCTAGTGGTGAGATTAATGATTGGAAAGCG
GAGTCGCGTGTGTGGACTCTTTGTCGCGAGATCCTTCTTGAGCAGCTCGTAGGCAACCCTAACAGTCTGGACCGAGCTCACGAGGCAGTTGCATTCATGC
TAAGGCACTCTGAAGTTCGTCTTCGACTCTTTGGAGCACAGGTGAAGTGGCGTCTTCTTGAATTTACTAGAAGAAATCGTACTAACTAGGAACATCGATT
CAGGTTCTTCGTGAGTTAATCTCCGAAAAATCATTTTCCTTTGACCCCGAGTATCGACGACGGAAGGAGTACGATCTTGTACCTCTTTGTCTGTCCCTTC
TCGAGTCGGCCGATGTCTACCTTCAGCATGAGAGCCTCGAACTTCTCCACGCTCTACTGCAATCGAAACATTTACAGGTTTGTCATGGCGTGTGTACGTT
TGGATGCAATCTTACTGATCAGTGGTGCAACAGGAGACTATTTGTGAGAAGCTCGTTCGCCTGGTTGGAGACAGTGCCAAGGCACTGGATGCGTATGTCA
ATCCGTCAGTGAATTGATGTTCACTTCCAACACATTTTGCTCACGATTGTGCGTCGGAATGTTTACTTGTATTCCAGCAAAGTTGAGGAGCGATTCGCCT
TAATCGAAGATACCACAGAGCATGAGACCTATGCCCACCTCCGATCAGCGTTCACTGCGGCTTCCCAAGCCGTTAACACGCTAATGAACTCGAACCGTAA
CATGCTACCGATTCTGGTACGTCGGGCACTCTAAACACCAGTCCGTGGCACTAACTGCAACTACTTGGGCAGGTGGATCGATATGATCTCCTGACTCCTC
TAGCATTTGTGCTCGCTGTTGAGCGACCTCACTCACTAAAATGGCACGCCGCTGCGATTAGTATCCAATTCATTATTTCGCACTACTACCCGGTAAAAAA
ACCACTTGACTGTTTTGTGTATACCTTCGTACTAATCGACGTATTGTGTGTTTGTGCGCTATCCTAGGGAGCGGCTCCTTTAATTGGTGAGTTATTCGAG
GTTTCAGTAGACGAACTTCTCGAATGGAAAGACAAACGAGGGGATGATGGCACGATGCTCGCTGAGTTTCTATTAGGCGATGAAGATCATCGAAGTCACC
TTGCTCTCCTATTTTACCAGCGCCAATGGTATCGCCCATTATTTCCGAGAAAACAGTTCGAGCAAGCGGATTCTGATCGCATTCTCAATGACATTGAGCA
AAATGTCGAGACAGCAGCACGCGACTACGTTCCTGAGGTGTGATTAGCGGTAGTGTTCTCATTGAATCCGTCTAACGAACTCTTTTTTTATTCTGTACTA
GCTGCAAGTCCAAACACGAGTAGGAGAGAACTCCGACGAGACGGAGGAAATGGACATCCTGGAGGCGCAGCGTGAGCACCACTTGCGCGTCCAATTACAG
AAGCATTTCGCTAAGTTCCGCCACATACCGACAGCAGTAACGACCACCAGCAGCAACTAGAAAAAGAGTTTGCAATCTACTTGATGTGAAATTAATACTG
CGAGGCCTCCAGGTCCCAGCCGAGAGCTCGTTAGCTCTCCTCGGGCGTGTAATGGTCCTCGAGGAAGCGCGATAATGTCTGCAGCTGCTCGGACACTACT
TTGACCTTCTCACGGCAGATCTCCATGTCCTTTTCGGCACCGTAGGTGCTACGTGCAAAGGTGCGGTAGTCTGAGACCAAGTGGATGTGGTTGGCCAACT
CGGTGTGGATCTCCTTGACTAGCTGTAGAAACTCGGTACATGTCGAGTTGAAGGCCAGCGATGAGCTTTCCTCAGACGCCACACGTGGCGCCATGAGCGA
CATGGCTGTGGCTGCCGTACGCAACGCCGTCACCAGTTTCTAGTGCCAGCAACAAATGGATAAGTCTGAAACTGTAATTCTTTAAGTGCCGCAAAAAAAA
ATTGGCGGTTGGTAATCACGCAACCATGCGCACATGCACGCACCTTCTCGACGGCGTCAAGCGCCTGCAGCACCGCCACATGCCGCGAGCTGGACCACGG
GTCGCTCACCTCCGAGAAGTGCACGCGACTATCACCTTCACCCTCCATGCCTCAGTGAAA