Description :
From Genome Similarity Track
Location :
Scaffold_624:2744- 4714
Sequence
1970 bases(100 bases per row)
AGAATTCGAGTGGGAAATTCATATATAGGATGATCCACCAACGGCCTTGAATACTCTTCCGCAGGTTCTTTCTCTCTTTCTGTAGTCGCGTCAAACGCTA
GCGTTTGCCATTCTGTATACCGCCGTGATCCGATTGATACATATCCCGGTGATCGGTGTATCATTTTGAATACCATCCACACACCTAACGAAGCCCCATG
ACCTAGAATTATATCGCGATCGCTGAGGTTCGTAAGCTGTAAATACTTGATCCGACCAGGCCCACGAGTCACTGTCGGCACCCACGCCACATCTCGCCTC
ACCCAAAGTGTAGCCTTAGGTGGACCAACCCCGATACGTACTTCCGTCGATTTGCCCACCGGAATGACCACATGTTGATCATTCAGGTTAATCGCATGCA
TGTTTGATCAATAAGGTGGCTTCCGTCCTGCCAAACCAATTCGCACCTCGTATGGTAGACATAATGTTCCGTCGGCTAAATCCAGACGAATGCCCGCTAG
AACCATAAAATCCATACCCAATGTGGATTCTTGGACGACTTGATCACGGACTCAAACGTCGAAATAATACACCACCAATCCGTCCTACGTGATCTTGATC
TTCGTCAGCCCCACCGTCATATATGAATTTTCTTTAATTCCCACGCACTCTTGTGTTTGACGTTCGTCAACAACACATCCTACATTACGAACAAAGGTAG
TATCGAGTATCGAAACTTCAGCGCCAGAGTCGAACAGCATAGTGGTCTTCTCATTGTTAATCTTGCCTGCCTCTTTTGCTTGGTTGGACCATTTTCCAGG
AGTGTGTTATCCAATACCCGCGCGATTCCCATGTTGAGAGGTCGAGCTCCATCCTCACAGGCGATCGGGCGTATTCATCAATCTTGTCACACTTGATATT
AAAAAAAACCCAATGTAAAATCATTATGGATATTAGCGATCGGATCGATCCGATCGTTAATCTCTTATTTCTTCCGTTTTCCTTCAACAAATGCATAAAT
GCAAAGCCTAGAATGCTCGGATCGTGCCAAATTCCAACCTGACGAGTGTCCTGGTTTAACATCTCCTCCACATTGGGGGAAACATTCCACCATGCTTTGT
GGGCACGTACCACTTGCGGATCAAGTTGAAAGATTCTTCCATTGGGCATTTGCCACTCCCGTGCATTTGTCCGCATGCTGCACACACAAAGAAGCATTTG
TCAGAGGGATGCCCTTTGCGACCACACTTCTGGCACGTCAATTTCTTCCAGCACCCTCGATCATTATGTCTGGTAGATCCACAATGGGTACACGACTTCG
ATCGTCCACCACGATCGTGTCCATTCCTTTCACTAGTGTTCTTCCGCCAGGTGAGGTGATCCTTGTCCGAATTTTCTTGGTCAGGTGTAGTTGTCACGCA
AACTTGACAATGATCCACGTCTTCATCGGATCCAATTGACTCTGATTCTGATCCGCTACTTTCGACTTTCTCGCGGATCGCTCGCACCGCTCGAGCTGTC
TTCGACGACCTTGGATTTGAAGACGTGGTCGTTCGCTGATGGAATTTGTTCAATCCCATCGACGCTTTTATCTGGCGATTCTCCATCCGTTGGCACTCAT
GTAGAGTTGTCTCCACCTCGTCAACATCCATCAATCGCAGTATAATAAGCCGTTTTGCTAGATCACAATCATCTAGCGTAGCAATGAAGTGGTCCACATG
TTCGCGACGTGTGGCCAAGATAGCCAATCTTTACTCTTTGATTGCGATCTTGGCGTGCTTTGCCGCGAAATTGAGGCGATAAAAGTATTCAAGCGGGGTT
TCATCGGATCTCTTCCGTGCAAGATAATATTGCCTAGCCACAGGCACCCCTTGCCCTCCATACTAAATCATAAAACAATCCAGCAATCGCTTCCACTTGT
GTCGTATAGATGGAACAGTTGGTTGTACCAGTTTCGTTCTGGTCCTATCAACAAATCGCCGAACACTAAA