Description :
From Genome Similarity Track
Location :
Scaffold_51:274330- 276168
Sequence
1838 bases(100 bases per row)
AACACCGGAATTTTCTTTATTGTCCCTCAGTCGCTTCAACTGATCTACACCCGTTTTCACATCATTTTCAACAAATTCAACAGTATAGAAGCAAGCACCA
ACACCGGGATATATTTTTTCAAGTAATGTTCTTATTGTAAATCACTGCCTTTAACCAGGCGTTTTTCTAGTCCCACGGCATTTCTCTGCTTCACACTTGC
ATGTAAACCACAACTGATCTCCGTAATCTACCGTCACTTCCTTGTCAGGTACAAATATCTTCAATCGCAACGACTACGACCGTTACGAACCTTCGATTCC
AGGCTTCGAAGAAGGCGCAGTTAGCCGAGCACGAATGGTTCATAAAGCGGGAGATAGAGCCTCGATCACGGGCTTCGATCGATAATTTTTCTTTTCTTGA
TGAACGAACCTACAGAGCAATAATATAATCACTCACTCTGTCTTGATCAAGCGAATAGTCATGTGCAGTTAAGACACCAGCGTACTCTGCTACAATTGTT
CCTTCGCTAATCCACTGCGTCGTAAAAACAAAATAACCGATTGACCCTTCAGCTAGTTGCAGGCAGTCTAGTTGCTGCAGCCGGTTTCCGCAGTGCACGC
CGTTTTGACAGTTATTTGAGGCGTAAAAAATGCTGCTTAGAGCATTGGGACAGCTCTCGGGATCACAAACATTTTTACAGCCACATTAATCTACTGGGCC
TAGGTCAGGAACAACTAAAACGTCGGGGTTCTCCGTGTGATCTATCTGGATAAATTCATCAGGCCAGGCTACAGATTTGTTGCTTCTCGTGCTCTACGTA
TAGCGGCGCCATGCTCGAGCGCGTCTCTCTCGCCTTGTTCTCTACTTTGCTGCAAAATGGGCGGAAATAGGATTGGTCACCTCCGACCAACAACGGGATT
TGCTGAATGCCAAGTTGCGACAGTATGTGAGTCGGTACGAAATTTGTGTTCACCATCTTGGTCTGTGATCAAAAACACTTTCTGTCACAACTTTAGTGTA
TCCACTCACCCGGTGTCATTTTCCTGAGTAAATACCTGGCCTGTTACACCTGGTAGCACTTTTTAGTCCTTCCAACGACCAAGTTCGACATGAGCCAAGA
CCTCGACCACCCTGCCTTTCTCCATCTCACTCGGATCGAGTGGGAGGCTCTCCACCGCCTCGCGGCGGTGTCCGGAGAAGCCGTCGTCACGTCGCTGCTG
CACTCCGCGACGCCCGACGAGCAGCGCGTTGCGGCACAAGAATTCATGGAACGCGAGCTCGCCGATGCGAATCGGCGAGTGTCAACTCCCTCGCGTATCT
CCACGAATGACGTCGTGAAGCTAGAGACATCCACCTACTCCGGTGCCGGAGAAGATCGACTTCCGCTAAATCGCTGGTTTCGAGAGATCGACATCGCCAT
CGCCTCGAGGTTGATCGAGGCGCCTTCCGCGAAGGTCCATTTCCTCCTCTCGCGGCTGTCTGGGAAAGCCAAGGAATGGGCTCTCGGCAAGTTGGTTGTC
GATCCCAACGTCTTCTTCACTCTGGATACCCTCCAGAGTGACCTTCGGCTCGCTTTCGAGCCGCCGCAAGATGAATCCCGAATTCGGGCAGACTTCTTCG
CCCTTCGGCAAGGCACGATGACTATGCGCGACTACGTCCAGAAGACACGACACCTTGCGTCGTGTATCGTGTCTAAGCCGATCGATATGGCCTCTCAGGT
TCATGTATTCGTGCTAGGTATGCACGAAGGCATGACGTGCTACTGCTTTACAAGATCGGACCCCTCTACGCTCGAAGAGGCATTCGCCCTCGCCCTACGC
GAGGACCTACGTGGTTGCGGCGTCATACGCTCACGCGC