Description :
From Genome Similarity Track
Location :
Scaffold_27:274214- 275614
Transcript NameFunction/comments
Hyaar_Emoy2804272hypothetical protein

Sequence
1400 bases(100 bases per row)
TTCCTTTGCATTTGTATGGCGATATAGCGATAGAACCATATCCAAGATCCGAAGCGTAGAGTACACAGATGGGCGAACTAAAGACCTACTATGTTACTTT
GCATTTGCCAACTTCAACTAGCATCGATCACTTCCTTTAGGTTATGAGCCCAAGCTCTGCTGACTCTGGCCACAACTCTGACCACTCCTTATCGATGGAC
TCTGCTCAGATCGCCACAGCTCGCATCAACAAGTTCTCCGGAACAAACTTCCGCACTTAGAAGTTCAAGATGCAGATGGTGCTGGAGGAGCGACATCTGT
GGGACGTCGTGAGCGGTGAGGTCAAGCTCGAGTACTGCAACAGTACTTCAAACCACGCAATGTTCAAGCAAAAGTCGCGAAAGGCGCTAGCTATCATCTG
TCTTGCAATGGAGTATTCGCAGTCGCCACTGGTCCGCTCGGGCGAAGGACTCGCATGATGCATAGTCACGTCTGGAAGGACACTACGAGAAGAAGAGCTT
GGCCAATAAGCTCTTCCTTAGTCGTCGCTTCTTCACGACAATGATAGGACAAGGTGATGACGTGCTTGAGCGCATCAACAGACTCAAAACTCTAGCGGAT
CAACTCGACGCAATTGGTGCTCCGGTCAGCGAGGACTACTTGGTCATCACGCTTCTAGCCAGCCTCAGCGAGTCGTACCAGTTACTAATTACAGCATTGG
AGTCGAGAGCCGACTCTCTCACGTGGGAACTAGTAAAGTCTCGGCTGTTGCACGCAGACATGAAGCGCAAGGAGCAAGGTGGAGGAATTAAAGGAGCTGC
GCACAGTCAAGCTCAAGCATTCATGTCTCGAGACAACAAGCGCAAGGCTCGACCGGAAAAGAAGATCGGTGTGCACCACAAGTGAGTAAAACAAGGATAC
TAGGTTTCGGAATGCCCCTCCCGAATCCAGGAAGACGCTAATAGACACCGGTTCCAGCGTGCGAATATGCAAGAACAAGAGTTTGGCGATTGTCTTTTCT
CGGTCGGTGGTGGCAAGACCAAGTCGAGTAACATGTGGCTGGTCGGCTTGGGTGCGACGCAGCACATGACCAGTTCAAAAAGGTTCATGAAGAACTACAA
GGATTTTGGCCCAGTAGATGTGCATCTTGCTGATGACGGTGTAGTCCAAGCAATTTGAAAAGGTGACACCGTTATGTCAATGAAGGCTCGCCAAGGGGTC
AAGAAGGGTGTGCTCACGGATGTGTGGTATATCCCAAAGTTATCGCGCAACATGTTTTCCGTTGGCCGATTCATCAACGACGTTGGACCGTTCGCATTCG
AGGTTGACGGTTGCTTTGCTGAAACAAAGGGTATCAAGTAGAAACTTGGCGACCTCGACGAAAAAGGACTGTTCAAGGCTGTATATGATACCGGAACTTT